ID: 992744063

View in Genome Browser
Species Human (GRCh38)
Location 5:79801962-79801984
Sequence CTGACTCTGTGGCAAGGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992744055_992744063 -1 Left 992744055 5:79801940-79801962 CCAGTGAGTGACCCTCCTGTCTC No data
Right 992744063 5:79801962-79801984 CTGACTCTGTGGCAAGGGGACGG No data
992744052_992744063 6 Left 992744052 5:79801933-79801955 CCACTCCCCAGTGAGTGACCCTC No data
Right 992744063 5:79801962-79801984 CTGACTCTGTGGCAAGGGGACGG No data
992744053_992744063 1 Left 992744053 5:79801938-79801960 CCCCAGTGAGTGACCCTCCTGTC No data
Right 992744063 5:79801962-79801984 CTGACTCTGTGGCAAGGGGACGG No data
992744048_992744063 23 Left 992744048 5:79801916-79801938 CCTCTAAGTCCAGCCCTCCACTC No data
Right 992744063 5:79801962-79801984 CTGACTCTGTGGCAAGGGGACGG No data
992744050_992744063 10 Left 992744050 5:79801929-79801951 CCCTCCACTCCCCAGTGAGTGAC No data
Right 992744063 5:79801962-79801984 CTGACTCTGTGGCAAGGGGACGG No data
992744051_992744063 9 Left 992744051 5:79801930-79801952 CCTCCACTCCCCAGTGAGTGACC No data
Right 992744063 5:79801962-79801984 CTGACTCTGTGGCAAGGGGACGG No data
992744054_992744063 0 Left 992744054 5:79801939-79801961 CCCAGTGAGTGACCCTCCTGTCT No data
Right 992744063 5:79801962-79801984 CTGACTCTGTGGCAAGGGGACGG No data
992744049_992744063 14 Left 992744049 5:79801925-79801947 CCAGCCCTCCACTCCCCAGTGAG No data
Right 992744063 5:79801962-79801984 CTGACTCTGTGGCAAGGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992744063 Original CRISPR CTGACTCTGTGGCAAGGGGA CGG Intergenic
No off target data available for this crispr