ID: 992744597

View in Genome Browser
Species Human (GRCh38)
Location 5:79806740-79806762
Sequence AAAACATGATACCCAAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992744597_992744605 19 Left 992744597 5:79806740-79806762 CCAGTGTTTGGGTATCATGTTTT No data
Right 992744605 5:79806782-79806804 TTTATAAAGGCCTCCTGGCCTGG No data
992744597_992744599 -8 Left 992744597 5:79806740-79806762 CCAGTGTTTGGGTATCATGTTTT No data
Right 992744599 5:79806755-79806777 CATGTTTTTCAATATCAAATGGG No data
992744597_992744600 -7 Left 992744597 5:79806740-79806762 CCAGTGTTTGGGTATCATGTTTT No data
Right 992744600 5:79806756-79806778 ATGTTTTTCAATATCAAATGGGG No data
992744597_992744601 -6 Left 992744597 5:79806740-79806762 CCAGTGTTTGGGTATCATGTTTT No data
Right 992744601 5:79806757-79806779 TGTTTTTCAATATCAAATGGGGG No data
992744597_992744603 6 Left 992744597 5:79806740-79806762 CCAGTGTTTGGGTATCATGTTTT No data
Right 992744603 5:79806769-79806791 TCAAATGGGGGGTTTTATAAAGG No data
992744597_992744602 -5 Left 992744597 5:79806740-79806762 CCAGTGTTTGGGTATCATGTTTT No data
Right 992744602 5:79806758-79806780 GTTTTTCAATATCAAATGGGGGG No data
992744597_992744598 -9 Left 992744597 5:79806740-79806762 CCAGTGTTTGGGTATCATGTTTT No data
Right 992744598 5:79806754-79806776 TCATGTTTTTCAATATCAAATGG No data
992744597_992744604 14 Left 992744597 5:79806740-79806762 CCAGTGTTTGGGTATCATGTTTT No data
Right 992744604 5:79806777-79806799 GGGGTTTTATAAAGGCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992744597 Original CRISPR AAAACATGATACCCAAACAC TGG (reversed) Intergenic
No off target data available for this crispr