ID: 992744604

View in Genome Browser
Species Human (GRCh38)
Location 5:79806777-79806799
Sequence GGGGTTTTATAAAGGCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992744597_992744604 14 Left 992744597 5:79806740-79806762 CCAGTGTTTGGGTATCATGTTTT No data
Right 992744604 5:79806777-79806799 GGGGTTTTATAAAGGCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992744604 Original CRISPR GGGGTTTTATAAAGGCCTCC TGG Intergenic
No off target data available for this crispr