ID: 992744977

View in Genome Browser
Species Human (GRCh38)
Location 5:79810593-79810615
Sequence GGAGAGACATCATTTCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992744970_992744977 18 Left 992744970 5:79810552-79810574 CCAGCAAAAGAGGCAACAAAGAA No data
Right 992744977 5:79810593-79810615 GGAGAGACATCATTTCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992744977 Original CRISPR GGAGAGACATCATTTCAGCT GGG Intergenic
No off target data available for this crispr