ID: 992747689

View in Genome Browser
Species Human (GRCh38)
Location 5:79835443-79835465
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992747683_992747689 21 Left 992747683 5:79835399-79835421 CCTGAAGATAGGAAACACTTGAT No data
Right 992747689 5:79835443-79835465 CCGGGGCCTGAGCTTGGTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr