ID: 992749531

View in Genome Browser
Species Human (GRCh38)
Location 5:79849564-79849586
Sequence TGCAGCCCCTGGACAAGTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 200}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992749531_992749540 10 Left 992749531 5:79849564-79849586 CCGCCACTTGTCCAGGGGCTGCA 0: 1
1: 0
2: 0
3: 17
4: 200
Right 992749540 5:79849597-79849619 GACTTAACCCCACAGCCATCGGG 0: 1
1: 0
2: 11
3: 14
4: 111
992749531_992749541 16 Left 992749531 5:79849564-79849586 CCGCCACTTGTCCAGGGGCTGCA 0: 1
1: 0
2: 0
3: 17
4: 200
Right 992749541 5:79849603-79849625 ACCCCACAGCCATCGGGATGAGG 0: 1
1: 0
2: 0
3: 34
4: 122
992749531_992749539 9 Left 992749531 5:79849564-79849586 CCGCCACTTGTCCAGGGGCTGCA 0: 1
1: 0
2: 0
3: 17
4: 200
Right 992749539 5:79849596-79849618 GGACTTAACCCCACAGCCATCGG 0: 1
1: 0
2: 1
3: 9
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992749531 Original CRISPR TGCAGCCCCTGGACAAGTGG CGG (reversed) Intergenic
900298672 1:1965676-1965698 GGCTGCCTCTGGACAAGAGGAGG - Intronic
900575778 1:3381900-3381922 CACAGCCCCTGTACAGGTGGTGG - Intronic
900757394 1:4446025-4446047 AGCAGCCCCTGGTCTAGTAGAGG - Intergenic
901181069 1:7342241-7342263 TGCTGCCTCTGGACAGGTCGTGG - Intronic
902288802 1:15423460-15423482 AGCAGCCCCAGGACACGTTGGGG + Intronic
902548868 1:17207668-17207690 TGCAGGCCCTGGCCCAGCGGAGG + Intronic
902920616 1:19664608-19664630 AGCAGCCCCTGGATAAGGGCAGG + Intergenic
904266833 1:29323190-29323212 TGCAGCCTGTGGGCAACTGGTGG + Intronic
905216452 1:36411708-36411730 AGCAGCCCCTGGAGAAGTAGGGG + Intergenic
905601323 1:39254293-39254315 TGCAGCCCCGGGAGAAGGGCAGG + Exonic
911085877 1:93977096-93977118 TGCAGCCCCTGGGCAACAGAAGG + Intergenic
916808938 1:168288353-168288375 TGCAGACCCTGGGAATGTGGAGG + Intronic
917829518 1:178865118-178865140 GGCACCACCTGGACAAGTGGGGG + Exonic
920342934 1:205286920-205286942 TGCAGTCTTGGGACAAGTGGTGG - Intergenic
924013916 1:239698801-239698823 TGCAGATCCTGGTCATGTGGAGG - Intronic
924500861 1:244636928-244636950 TGGAGACACTGGGCAAGTGGTGG - Intronic
1066063656 10:31746201-31746223 TGAAGCCCATGGCCAGGTGGCGG - Intergenic
1067685511 10:48464291-48464313 TGCAGGCACTGTACAAATGGTGG - Intronic
1071191344 10:83105018-83105040 TGGAGCCCCAGGACACCTGGTGG + Intergenic
1073605359 10:104889643-104889665 TCCAGCCCTTGGACAATTAGAGG + Intronic
1075415270 10:122258152-122258174 TGCAGCCCCTGGGGAGGAGGAGG - Intergenic
1076095979 10:127735702-127735724 TGAAGCCCCTTCAGAAGTGGTGG - Intergenic
1076818744 10:132927557-132927579 TGCAGCCGCTGGACAGGCCGGGG - Intronic
1076942850 10:133621344-133621366 TGCTGCCACAGGACAGGTGGTGG - Intergenic
1077187671 11:1242744-1242766 TGCAGTCCCTGGACTGGAGGAGG - Exonic
1077188631 11:1246515-1246537 TGCAGTCCCTGGACTGGAGGAGG - Exonic
1077189613 11:1250370-1250392 TGCAGTCCCTGGACTGGAGGAGG - Exonic
1077295945 11:1826382-1826404 TGCAGCACCAGGACAGGTGGGGG + Intergenic
1077410669 11:2402516-2402538 CACTGCCCCTGGACAAGTGGAGG - Intronic
1077423414 11:2463409-2463431 AGCACCCACAGGACAAGTGGTGG + Intronic
1077905641 11:6530732-6530754 TGAACCCCCTGTACAAGAGGAGG - Intronic
1078756205 11:14213061-14213083 TGCAGGCACAGGACAACTGGGGG - Intronic
1079077804 11:17394730-17394752 TGCAGCTCCTGGAGCATTGGGGG - Intronic
1079747890 11:24155864-24155886 TGCAGCCCTGGGACGAGTTGAGG - Intergenic
1080667119 11:34345604-34345626 AGCACCCACTGGACAGGTGGGGG + Intronic
1081582772 11:44363931-44363953 GGCAGGCCCTGGATAAGTAGTGG - Intergenic
1081814438 11:45930626-45930648 TGCAGCGCCTGGACAGGAGCTGG + Intronic
1083720912 11:64603128-64603150 TGCAGCCCCTGGGCCTCTGGGGG + Intergenic
1085444770 11:76593048-76593070 GGCAGTCCCTGGGAAAGTGGTGG + Intergenic
1085489944 11:76906169-76906191 TTCAGCCCCTGAACAAGCAGGGG - Intronic
1087640540 11:100750502-100750524 TGGAGCACCTGGACAAGGGAGGG + Intronic
1089711308 11:120316887-120316909 TGCAGCCCCAGACCAAGAGGCGG - Intronic
1090361376 11:126175162-126175184 TGCATCTCCTGGGCAGGTGGCGG - Intergenic
1091831559 12:3554089-3554111 TGATGCCCCTGGGCAGGTGGTGG - Intronic
1092206096 12:6614923-6614945 GGAAGGCCCTGGACAAGTTGGGG - Intergenic
1093884776 12:24447132-24447154 AGCAGCCCCTGCTCAAGAGGAGG - Intergenic
1093962680 12:25292532-25292554 TGAAGCCCCTAGCCCAGTGGAGG - Intergenic
1094666703 12:32527373-32527395 TGGTGCCCCTGGTCAAGTGAGGG - Intronic
1094817751 12:34204219-34204241 TTCAAGCCCAGGACAAGTGGCGG + Intergenic
1096466036 12:51848251-51848273 TGCAGCCCCCGCACCAGAGGGGG + Intergenic
1096994676 12:55831110-55831132 TGGGGACCCTGGACAAGCGGGGG - Intergenic
1097225763 12:57476082-57476104 TGCGGCGGCTGGACAGGTGGCGG + Exonic
1099100977 12:78439855-78439877 TGCAATCCCTGGACAAGTTCGGG - Intergenic
1100190432 12:92185162-92185184 TGCAGCCTCTGGCCAACAGGTGG - Intergenic
1100284235 12:93149683-93149705 TTCAGCCCCTGAACAAGGAGAGG + Intergenic
1104117200 12:125760984-125761006 TGCAGCCCCTGAAACAGGGGCGG + Intergenic
1105209081 13:18247383-18247405 GGCAGCTCAGGGACAAGTGGGGG - Intergenic
1105678901 13:22705634-22705656 TGCAGTGGCTGGACATGTGGCGG - Intergenic
1106116026 13:26818299-26818321 TCCAGCCCCTGTACTAGTGTAGG - Intergenic
1106379783 13:29225004-29225026 TGCAGCCCTAGGAAAGGTGGAGG - Intronic
1107456702 13:40562212-40562234 TGTAGCCCCTGGCTACGTGGAGG - Intronic
1108297286 13:49037040-49037062 TGCAGATCCTGGACCAGTTGAGG + Intronic
1112176882 13:97034582-97034604 TGCAGCCCCTGGGCAAGCCCTGG + Intergenic
1112496253 13:99907368-99907390 TGTAGGCACTGGACAAGTGTTGG + Intergenic
1113518910 13:110924379-110924401 TCAAGCCCCTGGATAGGTGGTGG - Intergenic
1113900438 13:113793885-113793907 TTCAGGCCATGGACCAGTGGTGG - Intronic
1114266706 14:21076575-21076597 AGCAGCCGCTGAACAAGGGGAGG - Exonic
1114678143 14:24459371-24459393 TGCAGCCCCTGGAGAAGACCTGG - Intergenic
1116736360 14:48697320-48697342 TGCAGCCCATGGAGCAGGGGGGG + Intergenic
1119030432 14:71188108-71188130 TGCAGCCTCTGGAGAAGCTGCGG - Intergenic
1119758544 14:77135533-77135555 TGCTGCCCCTGTGCCAGTGGAGG - Intronic
1119936997 14:78601074-78601096 TGCAGGTCCTGGACACATGGAGG - Intronic
1121281450 14:92702015-92702037 TGCAGCCCCCGGACAAAGGGAGG - Intergenic
1122283763 14:100639048-100639070 TGCACTCCCTGAACAGGTGGGGG - Intergenic
1123996414 15:25721002-25721024 TGCAGCCCCAGGCACAGTGGTGG + Intronic
1126436842 15:48645566-48645588 TGCACCCACTGGAGAAGCGGCGG + Exonic
1127277756 15:57462165-57462187 TGCAGCCCCTTGCAGAGTGGAGG + Intronic
1128252080 15:66170810-66170832 TGCAGCCCCTGTCCAGGAGGTGG + Intronic
1128561684 15:68672832-68672854 TGCAGTCCCTGGCCACTTGGTGG - Intronic
1128638734 15:69319868-69319890 TGCTGCCCCTGGACATGTGAAGG + Intronic
1129232705 15:74205674-74205696 TGCAGCCCCTGGGCAGATGGAGG - Intronic
1130220923 15:82018688-82018710 TGCAAGCCTTGCACAAGTGGAGG - Intergenic
1142191957 16:88722211-88722233 AGCTGCTCCTGGACAGGTGGGGG - Exonic
1142220755 16:88853837-88853859 AGCTCCCCCTGGACAGGTGGGGG + Intronic
1143032106 17:3973586-3973608 TCCAGCCCCTGCACCAGTAGGGG + Intergenic
1143771403 17:9171316-9171338 TGCTGCCCCTGCACATCTGGAGG - Intronic
1144836179 17:18157864-18157886 TGCAGCCGCTGCACAGGAGGTGG + Exonic
1145973926 17:28973471-28973493 TGCCTCCCCTGGACCAGAGGGGG - Intronic
1146575163 17:33984601-33984623 TGCATCCCCTTCACAATTGGGGG + Intronic
1146692667 17:34887513-34887535 TGCAGCCCCTGGACAGGGCATGG - Intergenic
1147374869 17:40017407-40017429 TGAGGCCCCTGGACAAGCAGAGG + Exonic
1152806440 17:82359088-82359110 TGCAGCCCCTGGGCACCTGCAGG - Intergenic
1155228928 18:23755282-23755304 TGGAGACCCTGGAGAACTGGAGG + Intronic
1156104047 18:33635442-33635464 TGCAGGCCCTGGCCTTGTGGAGG + Intronic
1157168982 18:45384669-45384691 GGCAGCCCCTGGACAGCTGGGGG - Intronic
1159439077 18:68454835-68454857 GGGAGCCCCTGGAAAAGTTGGGG + Intergenic
1159741205 18:72173388-72173410 TGCAGCCCCTTGAGAAGAGCAGG - Intergenic
1160907440 19:1458093-1458115 TCCAGCCCCCGAACAGGTGGTGG + Intronic
1161434824 19:4256950-4256972 TCCAGCCCCTGCTCAAGGGGAGG + Intronic
1163772946 19:19201799-19201821 GGCAGCTTCTGGACAGGTGGTGG + Exonic
925764700 2:7220668-7220690 TGCAGCCCATGGGCAAGTCCAGG - Intergenic
927017399 2:18979508-18979530 TGCAGGCCCAGGACTAGGGGTGG - Intergenic
927310099 2:21620747-21620769 TGCAGCCCTTGGACTAGCAGAGG + Intergenic
928262746 2:29782413-29782435 TGCAGCCCCTGGAAGTGTGAGGG - Intronic
928371848 2:30745620-30745642 TGCAGCCACTGAACACGTGGAGG + Intronic
929899192 2:45986720-45986742 TCCAGCCACTGGACATGAGGAGG + Intronic
931700792 2:64907495-64907517 TGCGCCACCTGGACAAGGGGAGG - Intergenic
932621009 2:73264979-73265001 TGAAGCCCCTGGTGCAGTGGGGG - Intronic
934460931 2:94213507-94213529 TGCAGCCCCTGGTCCTGTCGTGG + Intergenic
935018913 2:99211890-99211912 TGCAGTCCCTGGGCAAGTCCTGG - Intronic
935310149 2:101775583-101775605 TGCAGGCCCTGGGCTAGTGCTGG + Intronic
937864145 2:126735536-126735558 TGCTGCCCCTGGACATTTTGGGG + Intergenic
937866375 2:126754357-126754379 TGCTGCCATGGGACAAGTGGTGG + Intergenic
938975053 2:136469016-136469038 TGCAGCACCTGGCTCAGTGGTGG + Intergenic
941349254 2:164412368-164412390 TGCAGCCATTGAAAAAGTGGAGG + Intergenic
941466228 2:165830591-165830613 TGCAGGCTCTGGACAAAGGGAGG + Intergenic
943845015 2:192634710-192634732 TGCAGTTCCTGGACAAGTCCTGG + Intergenic
947917008 2:233839281-233839303 TGCAGCCCCTGGGAGGGTGGGGG + Intronic
948873358 2:240815057-240815079 TGCAGCTCTAGGACAAGTAGTGG - Intronic
1168838679 20:894915-894937 TGCAACCACAGGACAAGTGGGGG - Intronic
1171290253 20:23979097-23979119 GGCAGCTCAGGGACAAGTGGGGG - Intergenic
1172949610 20:38714457-38714479 TCCAGTGCCTGGACAAGAGGGGG - Intergenic
1172969198 20:38861259-38861281 TGCAGCACTGGGACAGGTGGGGG - Intronic
1172991092 20:39037515-39037537 TGCAGGCCCTGAAAAAATGGAGG - Intronic
1175717861 20:61267355-61267377 TGCAGCCCCTGGGGAATCGGAGG - Intronic
1175938720 20:62527265-62527287 TGCAGCCACTGCACCTGTGGTGG - Intergenic
1178777141 21:35562636-35562658 TGAAGCCCATAGAGAAGTGGAGG - Intronic
1179569959 21:42272936-42272958 TACAGCCCCTGGATTTGTGGGGG - Intronic
1180148330 21:45934294-45934316 TCCATTTCCTGGACAAGTGGCGG - Intronic
1180767175 22:18351915-18351937 GGCAGCTCAGGGACAAGTGGGGG + Intergenic
1180779135 22:18510464-18510486 GGCAGCTCAGGGACAAGTGGGGG - Intergenic
1180811855 22:18767784-18767806 GGCAGCTCAGGGACAAGTGGGGG - Intergenic
1181041497 22:20194709-20194731 CCCAGCCCCTGGTCAGGTGGGGG + Intergenic
1181286849 22:21758671-21758693 TGCAACCACAGGACCAGTGGAGG - Exonic
1181401736 22:22653779-22653801 GGCAGCTCAGGGACAAGTGGGGG + Intergenic
1182070839 22:27462581-27462603 TGCAGCCCCTGCGCAGGAGGGGG + Intergenic
1182366219 22:29781176-29781198 TGCAGCCCCAGGGCAAGAGGTGG - Intergenic
1184617811 22:45650021-45650043 GGCAGCCCTTGAACAGGTGGAGG - Intergenic
1185158782 22:49210050-49210072 GGCAGCCCCTGGAGGGGTGGGGG + Intergenic
1185338551 22:50281605-50281627 TGCAGCCCCCGCCCAAGCGGCGG - Exonic
1203228796 22_KI270731v1_random:92809-92831 GGCAGCTCAGGGACAAGTGGGGG + Intergenic
950239184 3:11352762-11352784 AGCAGGACCTGGACAAGTGTGGG + Intronic
950263231 3:11556896-11556918 TGCAGGCCTTTGAAAAGTGGAGG - Exonic
953421241 3:42754889-42754911 TGCAACCCCTTGATAAATGGGGG + Intronic
954232369 3:49227281-49227303 TGCAAACCCTGAAAAAGTGGTGG - Intronic
954751537 3:52816948-52816970 CGCATCCCCTGAACACGTGGTGG - Exonic
956989937 3:74751504-74751526 TGCAGCTCACTGACAAGTGGAGG + Intergenic
961405122 3:126672880-126672902 TCAAGCCCCTGGACCAGTGCTGG - Intergenic
961749138 3:129085451-129085473 TGCAACCCCTGGGCAAGATGGGG + Intergenic
961833033 3:129634148-129634170 TGCAGCCCAGTGACACGTGGTGG - Intergenic
962269301 3:133966478-133966500 TGCAGCCCCAGGCCAAGAAGAGG + Intronic
964980448 3:162670825-162670847 TTCAGCCCCTGAACAAGAAGGGG + Intergenic
969459640 4:7322180-7322202 TCCAGGCCCTGGCCATGTGGGGG - Intronic
969475510 4:7420478-7420500 AGCAGCCAGTGGACATGTGGGGG + Intronic
974015883 4:56648765-56648787 AGCAGCGCCTGGCAAAGTGGCGG - Exonic
976358830 4:84153639-84153661 TCCAGACCCTGAGCAAGTGGGGG - Intergenic
982338516 4:154268427-154268449 TGGAGACCCTGGACAAAAGGAGG + Intronic
983454458 4:167945419-167945441 TCCTGCCCTTGGACAAGTGTGGG - Intergenic
987987031 5:25161222-25161244 TGCATTTCCTGGACAAGTGGGGG + Intergenic
989339208 5:40354975-40354997 TGAAGCATATGGACAAGTGGAGG - Intergenic
992749531 5:79849564-79849586 TGCAGCCCCTGGACAAGTGGCGG - Intergenic
994553007 5:101260831-101260853 TGCAGACTCTGGACAAGCGATGG + Intergenic
998323313 5:141253793-141253815 TGCACTCCCTGGAAAAGGGGAGG + Intergenic
999244681 5:150147541-150147563 TGCAGGCCCTGGGCCTGTGGGGG - Intronic
999264063 5:150255177-150255199 TGCAGCCCCTGCACTGGAGGAGG - Intronic
1002273187 5:178086381-178086403 TGCAGCGCCTGGAGATGAGGAGG + Intergenic
1003260525 6:4511789-4511811 TGCAGTTCCTGGACAGGTGCCGG + Intergenic
1007077883 6:39079370-39079392 GGCAGCCCCTGGACTTGTTGGGG + Intronic
1013184351 6:107744997-107745019 TGCAGCCCCTGGGGAAGGGCTGG + Exonic
1013313603 6:108920553-108920575 TGCTGTCCCTGGAAAATTGGAGG - Intronic
1015052785 6:128862695-128862717 CCCAACCCATGGACAAGTGGTGG - Intergenic
1015567984 6:134593548-134593570 TGCAGTGTCTGGAAAAGTGGAGG + Intergenic
1017271087 6:152506289-152506311 TGCACCCCTTGAATAAGTGGAGG + Intronic
1018827562 6:167421272-167421294 TGGAGCCCCTGGGCGGGTGGAGG + Intergenic
1019635149 7:2071540-2071562 TGCAGCCCCTGGGCAGCTGCAGG + Intronic
1019941662 7:4297055-4297077 TGCAGGCCTTTGTCAAGTGGCGG + Intergenic
1023341067 7:39220418-39220440 TCCAGCCCCTTGACAAGAGATGG + Intronic
1023609781 7:41961059-41961081 TGCAGCCCCTGGGCTTGAGGTGG + Exonic
1023862603 7:44225267-44225289 TGCTGCCCTTGCAGAAGTGGAGG - Intronic
1023940278 7:44765055-44765077 GGCAGCCCCAGGACATGTCGGGG + Intronic
1026874122 7:73869949-73869971 TGCTGCCCCAGGCCCAGTGGGGG + Intergenic
1027145054 7:75688450-75688472 TGGAGCCCCTCGACGGGTGGGGG + Intronic
1029030571 7:97462274-97462296 TTCAGTCCCTGAACAAGTAGGGG + Intergenic
1029358452 7:100070466-100070488 TTCAGCCCCAGGACAACTGGGGG + Exonic
1029653343 7:101908723-101908745 TGGAGCCCCTGGCCTGGTGGGGG + Intronic
1029678440 7:102089961-102089983 TACAGACGCTGGACAACTGGTGG - Intronic
1031710168 7:125035027-125035049 TCCAGCGACTGGACAAGTTGAGG + Intergenic
1032092508 7:128918061-128918083 TGGATCCCCTGGAATAGTGGAGG + Intergenic
1034004411 7:147453269-147453291 TGAAGCACCTGGACTAGGGGAGG - Intronic
1035029094 7:155845580-155845602 TGCAGTCCCTGGACAAACAGAGG - Intergenic
1038398016 8:27261369-27261391 GCCAGCCCCTGGCCAAGCGGTGG + Intergenic
1047457850 8:125032334-125032356 AGCAGTCCCAGGACAAGTGGTGG + Exonic
1049200794 8:141339648-141339670 TGCTGCCCCAGGGCAGGTGGTGG + Intergenic
1049277976 8:141729423-141729445 CGCAGCCCCAGGACAGTTGGGGG - Intergenic
1049432890 8:142573521-142573543 TGCAGCCCCAGGCCATGAGGAGG + Intergenic
1049617273 8:143581139-143581161 TGCAGCTCCTGTACCACTGGGGG + Exonic
1049673648 8:143880330-143880352 TGGAGCCCCTGGGGAGGTGGTGG - Intergenic
1049762124 8:144336482-144336504 TGCCGCCCCTGGACAGGCGGGGG + Intergenic
1049820841 8:144632342-144632364 TGCAGGCTCTGGACAAGTGACGG - Intergenic
1050653518 9:7799341-7799363 TGCTGCCGCTGGTCAGGTGGTGG - Intronic
1052791814 9:32882135-32882157 TGCAGACGCTGGACAAAGGGAGG - Intergenic
1055468845 9:76591783-76591805 TCCAGGCCCTGGAGAAATGGAGG + Intergenic
1055640439 9:78315202-78315224 TGCAGCCCCTGGCAAAGCAGAGG + Intronic
1056705252 9:88946801-88946823 AGGAGCCCCTGGGCATGTGGTGG - Intergenic
1061667231 9:132167654-132167676 GGCAGCCCCTGGGTAAGTCGGGG + Intronic
1062125298 9:134857260-134857282 TGAAGCACCTGGACAAGAAGCGG + Intergenic
1062723843 9:138059847-138059869 AGAACCCCCTGGACATGTGGAGG + Intronic
1188515486 X:30981075-30981097 TGCAGCACTGGGACATGTGGTGG + Intergenic
1189004935 X:36985643-36985665 TGCAGCCGCTGGGCAAGTTCCGG - Intergenic
1189044091 X:37572301-37572323 TGCAGCCGCTGGGCAAGTTCCGG + Exonic
1189856738 X:45231270-45231292 TGGAGCATCTGGGCAAGTGGTGG + Intergenic
1190118441 X:47640849-47640871 TGAAACCCCTGGACCAGTGCTGG - Intronic
1190326637 X:49210679-49210701 TGCGGCCCCTGGAGGAGTTGGGG + Exonic
1191713652 X:64178801-64178823 TGCAGGCCCTGCACATATGGTGG - Intergenic
1193160097 X:78217936-78217958 TGCAGACCCTGGCCAAGTGACGG + Intergenic
1193590687 X:83385071-83385093 TCCAGCACCTGGTCCAGTGGAGG - Intergenic
1199345555 X:146734639-146734661 AGCAGGCCCTGGCCAAGTGATGG + Intergenic
1199390062 X:147268994-147269016 TGCAGACCCTGGCCAAGCGACGG - Intergenic