ID: 992751328

View in Genome Browser
Species Human (GRCh38)
Location 5:79865479-79865501
Sequence CTGTAGTCCCAGGTTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992751328_992751341 27 Left 992751328 5:79865479-79865501 CCCACCTCAACCTGGGACTACAG No data
Right 992751341 5:79865529-79865551 CTGTATTTCTAGTAGAGACGGGG 0: 12
1: 1786
2: 104602
3: 221668
4: 153235
992751328_992751333 -3 Left 992751328 5:79865479-79865501 CCCACCTCAACCTGGGACTACAG No data
Right 992751333 5:79865499-79865521 CAGGCGTGCACCACCACCCCTGG 0: 28
1: 1837
2: 15318
3: 60205
4: 172638
992751328_992751340 26 Left 992751328 5:79865479-79865501 CCCACCTCAACCTGGGACTACAG No data
Right 992751340 5:79865528-79865550 TCTGTATTTCTAGTAGAGACGGG 0: 21
1: 3085
2: 171619
3: 212404
4: 127032
992751328_992751339 25 Left 992751328 5:79865479-79865501 CCCACCTCAACCTGGGACTACAG No data
Right 992751339 5:79865527-79865549 TTCTGTATTTCTAGTAGAGACGG 0: 24
1: 3771
2: 201398
3: 141858
4: 67084

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992751328 Original CRISPR CTGTAGTCCCAGGTTGAGGT GGG (reversed) Intergenic
No off target data available for this crispr