ID: 992757955

View in Genome Browser
Species Human (GRCh38)
Location 5:79926656-79926678
Sequence CTACTTTCCTTCAGGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992757945_992757955 22 Left 992757945 5:79926611-79926633 CCAGAAGACTCTGGCCTTTCCAG No data
Right 992757955 5:79926656-79926678 CTACTTTCCTTCAGGAAAAAAGG No data
992757948_992757955 3 Left 992757948 5:79926630-79926652 CCAGGCTGTCTTCCACTTCTTTC No data
Right 992757955 5:79926656-79926678 CTACTTTCCTTCAGGAAAAAAGG No data
992757947_992757955 8 Left 992757947 5:79926625-79926647 CCTTTCCAGGCTGTCTTCCACTT No data
Right 992757955 5:79926656-79926678 CTACTTTCCTTCAGGAAAAAAGG No data
992757944_992757955 23 Left 992757944 5:79926610-79926632 CCCAGAAGACTCTGGCCTTTCCA No data
Right 992757955 5:79926656-79926678 CTACTTTCCTTCAGGAAAAAAGG No data
992757949_992757955 -9 Left 992757949 5:79926642-79926664 CCACTTCTTTCCCCCTACTTTCC No data
Right 992757955 5:79926656-79926678 CTACTTTCCTTCAGGAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992757955 Original CRISPR CTACTTTCCTTCAGGAAAAA AGG Intergenic
No off target data available for this crispr