ID: 992758319

View in Genome Browser
Species Human (GRCh38)
Location 5:79929979-79930001
Sequence GAAGCCAATGTGTCTTGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992758308_992758319 28 Left 992758308 5:79929928-79929950 CCATGCAAAGACCCTGAGTGGGG No data
Right 992758319 5:79929979-79930001 GAAGCCAATGTGTCTTGAGGGGG No data
992758310_992758319 17 Left 992758310 5:79929939-79929961 CCCTGAGTGGGGAGCATCCATGG No data
Right 992758319 5:79929979-79930001 GAAGCCAATGTGTCTTGAGGGGG No data
992758315_992758319 0 Left 992758315 5:79929956-79929978 CCATGGAGTGTTCAGGGAACAAA No data
Right 992758319 5:79929979-79930001 GAAGCCAATGTGTCTTGAGGGGG No data
992758312_992758319 16 Left 992758312 5:79929940-79929962 CCTGAGTGGGGAGCATCCATGGA No data
Right 992758319 5:79929979-79930001 GAAGCCAATGTGTCTTGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992758319 Original CRISPR GAAGCCAATGTGTCTTGAGG GGG Intergenic
No off target data available for this crispr