ID: 992758772

View in Genome Browser
Species Human (GRCh38)
Location 5:79933424-79933446
Sequence TTCATCAAATCCTAGCCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992758772_992758778 30 Left 992758772 5:79933424-79933446 CCAAATGGCTAGGATTTGATGAA No data
Right 992758778 5:79933477-79933499 GCTTCCAACTCAGGACCAAACGG No data
992758772_992758775 21 Left 992758772 5:79933424-79933446 CCAAATGGCTAGGATTTGATGAA No data
Right 992758775 5:79933468-79933490 TTTATCCCTGCTTCCAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992758772 Original CRISPR TTCATCAAATCCTAGCCATT TGG (reversed) Intergenic
No off target data available for this crispr