ID: 992758774

View in Genome Browser
Species Human (GRCh38)
Location 5:79933450-79933472
Sequence ATAAAAATGAGAAAGCCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992758774_992758775 -5 Left 992758774 5:79933450-79933472 CCAACAGGCTTTCTCATTTTTAT No data
Right 992758775 5:79933468-79933490 TTTATCCCTGCTTCCAACTCAGG No data
992758774_992758783 19 Left 992758774 5:79933450-79933472 CCAACAGGCTTTCTCATTTTTAT No data
Right 992758783 5:79933492-79933514 CCAAACGGGGAAAGCCAAATAGG No data
992758774_992758779 5 Left 992758774 5:79933450-79933472 CCAACAGGCTTTCTCATTTTTAT No data
Right 992758779 5:79933478-79933500 CTTCCAACTCAGGACCAAACGGG No data
992758774_992758780 6 Left 992758774 5:79933450-79933472 CCAACAGGCTTTCTCATTTTTAT No data
Right 992758780 5:79933479-79933501 TTCCAACTCAGGACCAAACGGGG No data
992758774_992758778 4 Left 992758774 5:79933450-79933472 CCAACAGGCTTTCTCATTTTTAT No data
Right 992758778 5:79933477-79933499 GCTTCCAACTCAGGACCAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992758774 Original CRISPR ATAAAAATGAGAAAGCCTGT TGG (reversed) Intergenic
No off target data available for this crispr