ID: 992758778

View in Genome Browser
Species Human (GRCh38)
Location 5:79933477-79933499
Sequence GCTTCCAACTCAGGACCAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992758772_992758778 30 Left 992758772 5:79933424-79933446 CCAAATGGCTAGGATTTGATGAA No data
Right 992758778 5:79933477-79933499 GCTTCCAACTCAGGACCAAACGG No data
992758774_992758778 4 Left 992758774 5:79933450-79933472 CCAACAGGCTTTCTCATTTTTAT No data
Right 992758778 5:79933477-79933499 GCTTCCAACTCAGGACCAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992758778 Original CRISPR GCTTCCAACTCAGGACCAAA CGG Intergenic
No off target data available for this crispr