ID: 992759559

View in Genome Browser
Species Human (GRCh38)
Location 5:79939455-79939477
Sequence TCCATATCTTGAGGGATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992759559_992759564 19 Left 992759559 5:79939455-79939477 CCTGCAATCCCTCAAGATATGGA No data
Right 992759564 5:79939497-79939519 TTGCTGTTTTTGTGAAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992759559 Original CRISPR TCCATATCTTGAGGGATTGC AGG (reversed) Intergenic
No off target data available for this crispr