ID: 992761556

View in Genome Browser
Species Human (GRCh38)
Location 5:79955218-79955240
Sequence TGCATCTCAGGGTGCCAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992761556_992761560 12 Left 992761556 5:79955218-79955240 CCTCCTTGGCACCCTGAGATGCA No data
Right 992761560 5:79955253-79955275 ATCCCCTGCCGTTGAACAAGTGG No data
992761556_992761565 16 Left 992761556 5:79955218-79955240 CCTCCTTGGCACCCTGAGATGCA No data
Right 992761565 5:79955257-79955279 CCTGCCGTTGAACAAGTGGAGGG No data
992761556_992761567 18 Left 992761556 5:79955218-79955240 CCTCCTTGGCACCCTGAGATGCA No data
Right 992761567 5:79955259-79955281 TGCCGTTGAACAAGTGGAGGGGG No data
992761556_992761569 23 Left 992761556 5:79955218-79955240 CCTCCTTGGCACCCTGAGATGCA No data
Right 992761569 5:79955264-79955286 TTGAACAAGTGGAGGGGGCAAGG No data
992761556_992761566 17 Left 992761556 5:79955218-79955240 CCTCCTTGGCACCCTGAGATGCA No data
Right 992761566 5:79955258-79955280 CTGCCGTTGAACAAGTGGAGGGG No data
992761556_992761563 15 Left 992761556 5:79955218-79955240 CCTCCTTGGCACCCTGAGATGCA No data
Right 992761563 5:79955256-79955278 CCCTGCCGTTGAACAAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992761556 Original CRISPR TGCATCTCAGGGTGCCAAGG AGG (reversed) Intergenic