ID: 992769416

View in Genome Browser
Species Human (GRCh38)
Location 5:80033622-80033644
Sequence GCTGACAAGCATGCAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 194}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992769413_992769416 -6 Left 992769413 5:80033605-80033627 CCCATTTTATCTAGACTGCTGAC 0: 1
1: 0
2: 0
3: 9
4: 117
Right 992769416 5:80033622-80033644 GCTGACAAGCATGCAGTGGAAGG 0: 1
1: 0
2: 1
3: 13
4: 194
992769414_992769416 -7 Left 992769414 5:80033606-80033628 CCATTTTATCTAGACTGCTGACA 0: 1
1: 0
2: 1
3: 9
4: 161
Right 992769416 5:80033622-80033644 GCTGACAAGCATGCAGTGGAAGG 0: 1
1: 0
2: 1
3: 13
4: 194
992769412_992769416 16 Left 992769412 5:80033583-80033605 CCTTCTTATTGCTCTCTAGTCTC 0: 1
1: 0
2: 0
3: 20
4: 255
Right 992769416 5:80033622-80033644 GCTGACAAGCATGCAGTGGAAGG 0: 1
1: 0
2: 1
3: 13
4: 194
992769411_992769416 23 Left 992769411 5:80033576-80033598 CCTTCTACCTTCTTATTGCTCTC 0: 1
1: 0
2: 1
3: 30
4: 391
Right 992769416 5:80033622-80033644 GCTGACAAGCATGCAGTGGAAGG 0: 1
1: 0
2: 1
3: 13
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992769416 Original CRISPR GCTGACAAGCATGCAGTGGA AGG Intronic
904327682 1:29738218-29738240 GCTGAGATGCATGCTGGGGATGG - Intergenic
904932956 1:34104942-34104964 GTTGAGAAGGTTGCAGTGGAAGG - Intronic
905896168 1:41547367-41547389 GTTGACAAGCAGGCAGTGGCAGG + Intronic
907025037 1:51109057-51109079 GCTGGCAAGGATGCAGAGAAAGG - Intronic
909567939 1:77076712-77076734 TTTTACAAGGATGCAGTGGAAGG + Intergenic
912314392 1:108653573-108653595 GCTGGCAAGGATGCAGAGAAAGG - Intronic
912909205 1:113740210-113740232 GCTGGCAAGGATGCAGAGAAAGG - Intronic
915925818 1:160018716-160018738 GGAGCCCAGCATGCAGTGGAAGG - Intergenic
917086995 1:171313602-171313624 TCTTACAAGCACACAGTGGAAGG + Intergenic
919932421 1:202229964-202229986 TCTGAAAAGCAAGCAATGGAAGG - Intronic
920492339 1:206426613-206426635 GCTGGCAAGGATGCAGAGAAAGG - Intronic
920732077 1:208496877-208496899 TCTGCCAGGCATGGAGTGGAAGG + Intergenic
920793262 1:209113045-209113067 GCTGACAAGTATCAAGTGAAAGG + Intergenic
922922012 1:229313410-229313432 CCAGACCAGCAGGCAGTGGAGGG + Intergenic
923658315 1:235937502-235937524 GCTGACCAGCAAGCAGTGGATGG + Intergenic
1063012739 10:2041292-2041314 GAGGAAAAGCATGCAGTGGATGG + Intergenic
1063056513 10:2510464-2510486 GCTGACAAGCACGCAAGTGAAGG + Intergenic
1063141503 10:3260107-3260129 GCTCAGCAGAATGCAGTGGAAGG + Intergenic
1065706574 10:28476342-28476364 GGTGAGAGGCAGGCAGTGGAGGG + Intergenic
1066707420 10:38196576-38196598 GCTGTCAAGCTTACAGTAGAAGG + Intergenic
1066982277 10:42428155-42428177 GCTGTCAAGCTTACAGTAGAAGG - Intergenic
1067148926 10:43713814-43713836 GCCGAAAAGCATGCTGTGGATGG - Intergenic
1067372282 10:45696326-45696348 GCTGCCAAGCCTACAGTAGAAGG + Intergenic
1067387497 10:45829814-45829836 GCTGCCAAGCCTACAGTAGAAGG - Intronic
1067418630 10:46127453-46127475 GCTGCCAAGCCTACAGTAGAAGG + Intergenic
1067446774 10:46354797-46354819 GCTGCCAAGCCTACAGTAGAAGG + Intergenic
1067503981 10:46834029-46834051 GCTGCCAAGCCTACAGTAGAAGG + Intergenic
1067590608 10:47505970-47505992 GCTGCCAAGCCTACAGTAGAAGG - Intronic
1067637727 10:48014072-48014094 GCTGCCAAGCCTACAGTAGAAGG - Intergenic
1067755422 10:49001120-49001142 GGTGACAAGCATGCTCTGCAAGG - Intergenic
1067875765 10:50006273-50006295 GCTGCCAAGCCTACAGTAGAAGG + Intronic
1068212990 10:53946224-53946246 GCAGCCCAGAATGCAGTGGAGGG + Intronic
1068768261 10:60789887-60789909 GCTGATAAGGATGCAGAGAAAGG - Intronic
1069778631 10:70941254-70941276 CCAGAGAAGCATGGAGTGGAGGG - Intergenic
1070134326 10:73678493-73678515 GCTGCCAAGCCTACAGTAGAAGG - Intronic
1070532650 10:77350686-77350708 GATGATATGCATGCAGGGGAAGG - Intronic
1070751067 10:78964176-78964198 ACTGACCAGCAGGCAGTGAAGGG - Intergenic
1070815281 10:79318777-79318799 GCTGAGAAGCCTGCATGGGAAGG - Intergenic
1071607391 10:87005914-87005936 GCTGCCAAGCCTACAGTAGAAGG + Intergenic
1072570964 10:96657151-96657173 GATGACAATCATGGAGGGGAAGG + Intronic
1073983674 10:109183653-109183675 GCTGGCAAGGATGCAGAGAAAGG - Intergenic
1074122471 10:110503103-110503125 GCTGCCAAGCATCCTGTGGCTGG - Intronic
1076611889 10:131731288-131731310 GCTGGCAAGCTTGCAGGGAAGGG + Intergenic
1082000013 11:47389129-47389151 GGTGACAGGCAAGCACTGGAGGG + Intergenic
1085736731 11:79045547-79045569 ACTGACAGGTCTGCAGTGGAGGG + Intronic
1086453837 11:86942583-86942605 GATGAAAATCAGGCAGTGGATGG + Intronic
1090645819 11:128765727-128765749 ACTGACAAGGATGCAGGGAAAGG + Intronic
1091524482 12:1284574-1284596 GCTGGCAAGGATGCAGAGAAGGG - Intronic
1093330875 12:17836895-17836917 GCTGGCAAGGATGCAGAGAAAGG - Intergenic
1100948535 12:99817650-99817672 ACTGGCAAGGATGCAGAGGAAGG - Intronic
1102505883 12:113384433-113384455 GCTGAGGAGCCTGCAGGGGAGGG - Intronic
1103291439 12:119849464-119849486 GCAGACATGCATGAAGTTGAAGG - Intronic
1104405179 12:128511029-128511051 GCTGGCAGGCATGGAGTGGTTGG + Intronic
1106372845 13:29153419-29153441 GCTGAGAAACAGGCAGAGGAGGG - Intronic
1106480963 13:30136470-30136492 GATAACATGCATGGAGTGGAGGG - Intergenic
1107318758 13:39163053-39163075 GCTGGCAAGGATGCAGAGAAAGG - Intergenic
1108290434 13:48954941-48954963 GCTGAAAAGGAGGCTGTGGAAGG - Intergenic
1111566137 13:90018695-90018717 CATGACAAGAATGCAATGGAGGG - Intergenic
1111749223 13:92306593-92306615 GCTTGAAAGCATGCAGTGAATGG + Intronic
1112399377 13:99062638-99062660 GCAGAAAAGCAGGCAGCGGATGG - Intronic
1113274995 13:108718638-108718660 GCTGGCAAACAGGCAATGGAGGG + Intronic
1114491592 14:23105728-23105750 GCTTATAGGCATGCAGAGGAGGG + Intergenic
1114786797 14:25609453-25609475 GCTGTAAAGCATGCAGTGAAGGG + Intergenic
1116309415 14:43304201-43304223 GCTGAGAAGAAGGAAGTGGAGGG + Intergenic
1116982039 14:51181862-51181884 GAGGACAAGCATGCAGTAAAGGG + Intergenic
1117950058 14:61073859-61073881 GCTGAGAAGAAGGCAGGGGAGGG - Intronic
1119484632 14:74979586-74979608 GCTGAGCAGCTGGCAGTGGAGGG + Intergenic
1119758050 14:77132573-77132595 TCTGCCAGGCATGCTGTGGAAGG - Exonic
1123962298 15:25416841-25416863 GCAGACATCCAAGCAGTGGATGG - Intronic
1124219373 15:27835883-27835905 CCTGAAAAGTATACAGTGGAGGG + Intronic
1125528943 15:40398506-40398528 GCTGTTAAGCATGTTGTGGAAGG + Intergenic
1125761754 15:42100874-42100896 GCTGAGAGACATGGAGTGGAAGG - Intergenic
1126351987 15:47753409-47753431 GCTGACAAGGACACAGAGGATGG + Intronic
1127563274 15:60161749-60161771 ACTGACCAGCATGGAGAGGAAGG - Intergenic
1129269998 15:74414584-74414606 GCTGGCTTGCATGCGGTGGACGG + Exonic
1130651905 15:85766835-85766857 GCTCACCAGCATGCAAGGGATGG - Intronic
1132605985 16:793936-793958 GCTGAGAAGAATGAAGTGGGTGG + Intronic
1133047412 16:3096463-3096485 ACTGTCCAGCATGCAGTGGCTGG + Intronic
1136576429 16:31127967-31127989 GCTCCAAAGCATGCAGTGGTGGG + Intronic
1137546670 16:49409399-49409421 GCTGCCAAGCAGGGAGTTGAAGG - Intergenic
1141711535 16:85702274-85702296 GCTGCTAAGCAGGCAGTGGAGGG + Intronic
1142009971 16:87708976-87708998 ACAAACAAGCATGCTGTGGACGG + Intronic
1142235518 16:88920781-88920803 GCTGGCAAGCAGGCAGGGCAGGG - Intronic
1142970321 17:3606884-3606906 CCTGCCCAGCATGCAGTGGATGG - Intergenic
1144103166 17:11961957-11961979 GCTGCCAGGCCTGCTGTGGAAGG - Exonic
1146828744 17:36047856-36047878 ACTGAGAAGCAGGCAATGGAGGG + Intergenic
1148797950 17:50206168-50206190 GCTGAGAATAATGCACTGGATGG + Intergenic
1149657499 17:58318076-58318098 GCTTGCAGGCAGGCAGTGGAGGG + Intronic
1152065646 17:78111370-78111392 GCTGGCAAGCCAGCAGTGGCAGG + Exonic
1152591893 17:81217638-81217660 GCAGACAGGCATGCAGGGGTGGG + Intronic
1153479318 18:5531018-5531040 GCTGGAAAGCATTCAGGGGAAGG - Intronic
1156625582 18:38903663-38903685 GCTGAGGAGCAGGCAGAGGATGG - Intergenic
1157304044 18:46503746-46503768 CCAGAAAAGCATGCAGTGGAAGG - Intronic
1157538547 18:48481238-48481260 GTTGGCAAGCATGCAGAGAAAGG + Intergenic
1164487614 19:28673251-28673273 GCTTACAAGCAAGCACTGAAAGG + Intergenic
1164872394 19:31656838-31656860 ACTCACAAGCATTGAGTGGAAGG + Intergenic
1166910615 19:46153311-46153333 GCTGGCAAGGATGCAGAGAAAGG - Intronic
1166923257 19:46246782-46246804 GCTGGCAAGGATGCAGAGAAAGG + Intergenic
925640941 2:5985389-5985411 GATGACAAGGAGGCACTGGAAGG - Intergenic
926002102 2:9341719-9341741 GCTGAGAACAATGCTGTGGAAGG - Intronic
926364279 2:12118781-12118803 GGTGACAATCAGGCTGTGGAAGG - Intergenic
933989230 2:87621760-87621782 CCTGATGAGCATCCAGTGGAAGG - Intergenic
934575163 2:95395627-95395649 GCTGACAGGCTAGCTGTGGAAGG + Intergenic
934981161 2:98843036-98843058 GCTGATAAGGATGCATTGAAGGG - Intronic
936304613 2:111329066-111329088 CCTGATGAGCATCCAGTGGAAGG + Intergenic
941316174 2:163995247-163995269 ACTGATAAGTATGCAGGGGAAGG + Intergenic
942902800 2:181143262-181143284 GCTCTCAAGCATACAGTAGACGG + Intergenic
946961776 2:224993061-224993083 ACTGAAAATCAGGCAGTGGAAGG + Intronic
947305234 2:228738882-228738904 GCTGGCAAGGATGCAGAGAAAGG - Intergenic
947774651 2:232697768-232697790 GCGGAGAAGCAAGCAGAGGAAGG - Intronic
947827940 2:233118784-233118806 GCTGACAAGTGTGCTGAGGAGGG - Intronic
947938477 2:234027420-234027442 CCTGACAAGAATGGAGGGGATGG - Intergenic
1168934045 20:1647597-1647619 ACTAACAATCCTGCAGTGGATGG - Intronic
1169530977 20:6484481-6484503 GCTGAGAAACTTGCAGTAGAAGG + Intergenic
1169692278 20:8345198-8345220 GCTGACATGGATGCATTTGAAGG + Intronic
1169775946 20:9253330-9253352 GCTGACAGGCAAGGAGAGGAAGG - Intronic
1170920869 20:20678404-20678426 GTTGTCAAGCATGGAGTGGAAGG - Intronic
1172797299 20:37549631-37549653 GCTGGCAAGGAGGCAGAGGAAGG - Intergenic
1173526832 20:43739109-43739131 GATGAGAAGCCTGCACTGGAGGG - Intergenic
1177279221 21:18957781-18957803 GCTGCCAAGGATGCAGAGAAAGG - Intergenic
1181348109 22:22235249-22235271 GCTGACAAGCAGGCATTGGCTGG - Intergenic
1182710984 22:32323253-32323275 TGTGAAAAGCATGCAGGGGAGGG - Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1182783481 22:32886857-32886879 GCTGCCAAGTATGGACTGGAAGG + Intronic
1183339256 22:37270151-37270173 GCTGGCAAGAATGCAGAGAAAGG + Intergenic
1184725742 22:46344648-46344670 GCTGTCAGGCACGCTGTGGAAGG + Intronic
949274624 3:2264251-2264273 GCTGGCAAGAATGCAGAGAAAGG - Intronic
949878818 3:8645568-8645590 ATTGCCAAGGATGCAGTGGAGGG - Intronic
953565516 3:44028735-44028757 GCTGGCAAGCACTCAGTAGACGG + Intergenic
954778780 3:53045032-53045054 GCTGAAAAGGAGGCTGTGGAGGG - Intronic
956855063 3:73268022-73268044 GCTGGCAAGAATGCAGAGAAAGG - Intergenic
957525970 3:81379071-81379093 GCTGATAAGCTTGCCATGGAGGG - Intergenic
959050093 3:101516263-101516285 GATGAAAAGCATTCTGTGGATGG + Intergenic
959202621 3:103268490-103268512 GCTGATATGCATGCAGTTTATGG - Intergenic
960930957 3:122849461-122849483 GCTGACAAGGATACAGAGAAGGG - Intronic
961641003 3:128364820-128364842 GCTGCCATGCAGGCTGTGGAGGG - Intronic
963614675 3:147520808-147520830 GCTGACAAGGATGTAGAGAAAGG - Intergenic
963772291 3:149399941-149399963 GCTGACAAGGATGCAGAAAAGGG + Intergenic
964129678 3:153272821-153272843 CCTGAGAAGCATACAGGGGAAGG + Intergenic
969209665 4:5677271-5677293 GCTCACATGCAATCAGTGGAGGG + Intronic
969728009 4:8936776-8936798 GCTGATAAGGATGCAGAGAAAGG + Intergenic
970869997 4:20805052-20805074 GCTGACAAGTAGGTAGTGGTAGG + Intronic
970870350 4:20809932-20809954 GCTGACAAGCATGCTGTTTAGGG + Intronic
971257299 4:25026686-25026708 GCTTACAAACATGCTGGGGAAGG - Intronic
973844693 4:54899557-54899579 GCTAACAGGCGTGCAGTGGCTGG - Intergenic
973853511 4:54986567-54986589 GCTGACAAGGAAGCAGTATATGG + Intergenic
973967199 4:56175308-56175330 GCTGGCAAGGATGCAGAGAAAGG - Intronic
975653387 4:76616725-76616747 GATGAGAAGCATCCTGTGGATGG + Intronic
979306012 4:119144310-119144332 GCTGAATACCATGCTGTGGATGG + Intronic
979369207 4:119863151-119863173 ACTGAAAAGCATCCATTGGAAGG + Intergenic
981075527 4:140587493-140587515 GCTCAGAAGTATGCAGTGAAGGG + Intergenic
982016335 4:151157445-151157467 GCTGGCAAGAATGCAGAGAAGGG + Intronic
983130789 4:164016650-164016672 GCTGGGAAGGATGCTGTGGAGGG + Intronic
983910481 4:173233370-173233392 GCTGGCAAACATGCAGAGTAAGG - Intronic
984622252 4:181967097-181967119 GTAGACAAGCAGGGAGTGGAAGG - Intergenic
990621060 5:57558717-57558739 GATGACATGTATGCAGGGGAAGG + Intergenic
991647132 5:68811628-68811650 GCTGGCAAGGATGCAGAGCAAGG - Intergenic
992079379 5:73219661-73219683 CCTGAAAGGCATGCAGAGGAGGG - Intergenic
992769416 5:80033622-80033644 GCTGACAAGCATGCAGTGGAAGG + Intronic
995742839 5:115373215-115373237 GCAGACAGGCATGCAGATGACGG - Intergenic
996447498 5:123572692-123572714 GCAAACCACCATGCAGTGGAGGG - Intronic
997528736 5:134569565-134569587 GCTGACAAGCAGGCTGTGCAGGG + Intronic
998623189 5:143816839-143816861 GCTGGCATGGATGCAGTGAACGG - Intronic
1002464948 5:179403542-179403564 GCTTACACTCATGCCGTGGACGG - Intergenic
1004171835 6:13301273-13301295 GCTCACAAGCACGCTGGGGAGGG + Intronic
1004913405 6:20308348-20308370 GCTGAAAAGCTATCAGTGGACGG + Intergenic
1006190966 6:32208767-32208789 GCTGGCAAGGATGCAGAGAAAGG + Intronic
1008336204 6:50307713-50307735 GCTGATATGCATGTAGTTGAGGG - Intergenic
1009703024 6:67208182-67208204 GCTGGCAAGGATGCAGAGAAAGG + Intergenic
1009766926 6:68089598-68089620 GCTTACATGCATGCAGATGATGG - Intergenic
1010016266 6:71107985-71108007 CATAACAAGCTTGCAGTGGAGGG + Intergenic
1010133286 6:72521268-72521290 TCTGAGAAGCACGCAGGGGAAGG - Intergenic
1010155508 6:72787660-72787682 GCTGACAGGCATGGACTGGGAGG - Intronic
1017600598 6:156076623-156076645 AAAGACAAGCATGCAGGGGAGGG + Intergenic
1022123167 7:27329679-27329701 GCTGTTAAGAATGCAGTAGAAGG + Intergenic
1022478959 7:30730616-30730638 GCTGAGAAGCAAGCAAAGGAAGG + Intronic
1023217054 7:37873912-37873934 GCTGCCAAGTATGCAGTTGGTGG - Intronic
1036042508 8:5101640-5101662 GCAGACAAGCATGGAGAGAAGGG + Intergenic
1039965575 8:42281352-42281374 GCTGACATCCCTGGAGTGGATGG + Intronic
1041324787 8:56652701-56652723 GCTGACAAACATGCTGGGGAAGG + Intergenic
1042015895 8:64310764-64310786 GTTGGCAAGGATGCAGTGAAAGG + Intergenic
1043624016 8:82232316-82232338 GCTGACAAGGATGCAGAGAAAGG + Intergenic
1044291814 8:90480750-90480772 GCTGGCAAGGATGCAGAGAAAGG - Intergenic
1047728768 8:127708345-127708367 GCTGAAAAGCAGGAACTGGAAGG + Intergenic
1049297707 8:141851936-141851958 GGTGACAACCCTGCAGGGGACGG + Intergenic
1050387648 9:5108005-5108027 GCTGATAAGTAGGCTGTGGATGG - Intronic
1052735431 9:32337554-32337576 GCTGACAAGGTTGCAGAGAAAGG + Intergenic
1053005086 9:34599030-34599052 GCTCAGGAGCATGCAGTGGTTGG + Intergenic
1057735788 9:97658514-97658536 GCTGACAACCAAGAAGTGAAAGG - Intronic
1058181484 9:101805769-101805791 GCTGACGAGCATGTAGGGAAAGG + Intergenic
1058813686 9:108664801-108664823 GCTGACAAGCATGTTATTGAAGG - Intergenic
1060478494 9:124002037-124002059 GCTGCCAAGCAGGCTGGGGATGG + Intronic
1061800984 9:133113318-133113340 ACTGTCCAGCATGCTGTGGACGG + Intronic
1061981601 9:134107681-134107703 GCTGGCAAGGATGCAGAGAAAGG + Intergenic
1186178980 X:6954417-6954439 GGTGAGAAGGATGCAGTGCATGG - Intergenic
1188064519 X:25642076-25642098 GCTGGCAAGGATGCAGAGAAAGG - Intergenic
1188175573 X:26984774-26984796 GCTGGCAAGCATGCGGAGAAAGG + Intergenic
1190802122 X:53799275-53799297 GTTGACAAGGATGCAGAGAAGGG + Intergenic
1191210615 X:57881332-57881354 GCTGGCAAGGATGCAGAGAAAGG + Intergenic
1193924858 X:87472098-87472120 GTTGACATGGATGCAGTGAAAGG + Intergenic
1194844768 X:98791612-98791634 GCTGACAAGGCTGCAGAGAAAGG + Intergenic
1195496745 X:105544801-105544823 ACTGAAAAGAATGCAGTGAAGGG - Intronic
1196794707 X:119492820-119492842 CCTGACAAGAATGCAGGGGCAGG - Intergenic
1197646204 X:129019899-129019921 GCTGTCAAGGATGCAGAGAAAGG - Intergenic
1199432177 X:147774052-147774074 TCTGAAAAGCTTGCAGGGGAAGG + Intergenic
1200046941 X:153408258-153408280 GCTGCCACTCAGGCAGTGGACGG + Intergenic
1200229134 X:154435405-154435427 GCTGACATACTCGCAGTGGAAGG - Exonic
1200381283 X:155839972-155839994 GCTGGCAAGGATGCAGAGTAAGG + Intergenic
1202076647 Y:21043503-21043525 GATGAGCAGCCTGCAGTGGAGGG + Intergenic