ID: 992770432

View in Genome Browser
Species Human (GRCh38)
Location 5:80042321-80042343
Sequence GCTGATCCACAGATGAAGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992770432_992770433 6 Left 992770432 5:80042321-80042343 CCGTTCTTCATCTGTGGATCAGC 0: 1
1: 0
2: 1
3: 16
4: 170
Right 992770433 5:80042350-80042372 TCCTAACCTGTCTATTTCAGAGG No data
992770432_992770436 29 Left 992770432 5:80042321-80042343 CCGTTCTTCATCTGTGGATCAGC 0: 1
1: 0
2: 1
3: 16
4: 170
Right 992770436 5:80042373-80042395 CATTGCAAAGATTTTTCTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992770432 Original CRISPR GCTGATCCACAGATGAAGAA CGG (reversed) Intronic
901210717 1:7524546-7524568 GCTCTTCCACAGATGAGGAATGG - Intronic
901539274 1:9904700-9904722 GCTGATGCATTTATGAAGAATGG + Intronic
902720473 1:18300930-18300952 GAGGACCCAGAGATGAAGAAGGG - Intronic
906519525 1:46458894-46458916 GGTGAGCCACAGAGGAGGAAAGG + Intergenic
913373736 1:118129094-118129116 GCTCCTACACAGATGAAGGAAGG + Intronic
913477215 1:119249723-119249745 TCTGTTCCAAAGAGGAAGAAGGG + Intergenic
914897866 1:151692948-151692970 GATGGGACACAGATGAAGAAGGG + Exonic
916517065 1:165528391-165528413 CCTGATCACTAGATGAAGAAAGG + Intergenic
916798350 1:168189118-168189140 GCTGATCCAGAGAAGAAGCTGGG - Intronic
916913711 1:169383182-169383204 CCTAATCCACAGAAGAAAAAGGG + Intronic
917944624 1:179955456-179955478 CCTGATCGCCAGATGAAGAAGGG - Intronic
919155778 1:193764428-193764450 GCTGATCCACAAATGAAGGATGG - Intergenic
920302721 1:204998778-204998800 GATGAACCAAAAATGAAGAAAGG + Intronic
920966167 1:210702814-210702836 GCTGCAGCACAGATGCAGAAGGG - Intronic
921621104 1:217327298-217327320 TCTGATTTACAGATGAAGGAAGG + Intergenic
923252111 1:232187031-232187053 GCTGATCCAAAGAGTAGGAAAGG - Intergenic
923335364 1:232965399-232965421 TCTGTTTCACAGATGAGGAAAGG - Intronic
923644631 1:235805402-235805424 GCTGATGCGCAGATGGTGAATGG + Intronic
923648021 1:235844543-235844565 TCTAATCGACAGAAGAAGAAAGG - Intronic
1063799582 10:9558173-9558195 TCAGATGGACAGATGAAGAAAGG + Intergenic
1069248230 10:66235160-66235182 GCTGATCCACAGAAAATGAGAGG + Intronic
1071990347 10:91095277-91095299 GCTGATCCAGACAACAAGAAGGG + Intergenic
1073654461 10:105397934-105397956 GGTGATACACAGAAGAAAAAAGG + Intergenic
1075236177 10:120731339-120731361 CCTGAGCTACAGATAAAGAAAGG - Intergenic
1075783772 10:125034177-125034199 CCTGATTCACAGCTGCAGAACGG + Intronic
1081256243 11:40899230-40899252 GTAGATGCACAGCTGAAGAAAGG - Intronic
1084454315 11:69258798-69258820 GCTGATCTACAGATGAAATTGGG - Intergenic
1085687035 11:78632921-78632943 TCTGAGCCACAGAAGGAGAAGGG + Intergenic
1088650672 11:111955401-111955423 GCTGATCCAGAGCTGGAGCAGGG + Intronic
1089280088 11:117368203-117368225 GCTGACCCAGGGATCAAGAAAGG + Intronic
1089730479 11:120515938-120515960 CCTTTTCCACAGATGAGGAAGGG + Intronic
1090207842 11:124895736-124895758 GCCGATCCAGAGCTCAAGAAAGG - Intronic
1090629767 11:128635987-128636009 GCGGAGCCACAGGTGAAGCAGGG + Intergenic
1091016239 11:132053351-132053373 GGTCACCCATAGATGAAGAACGG + Intronic
1091833417 12:3567117-3567139 GTTGATCCACAGATGGAGAGGGG - Intronic
1092596919 12:10017033-10017055 GCTGAGTCACAGCTGAAGCATGG - Intronic
1094061904 12:26323185-26323207 TCTCATCCATAGATGAAGATAGG - Intergenic
1096239503 12:49952078-49952100 TCTGTCCCACAGATGAGGAAGGG - Intronic
1096765837 12:53888552-53888574 GCTGATGGACAGATTAAAAATGG + Intergenic
1097889402 12:64761866-64761888 CCTGATCCAGACATCAAGAAAGG - Intergenic
1098839024 12:75456636-75456658 GCTGAACCAGAGAGAAAGAAAGG - Intergenic
1100436232 12:94573827-94573849 GGAGATCCACGGGTGAAGAAGGG - Intronic
1100672058 12:96824195-96824217 GCTGCCACAGAGATGAAGAAGGG - Intronic
1102479708 12:113213542-113213564 TCTATTTCACAGATGAAGAAAGG + Intronic
1102635041 12:114315956-114315978 CCTATTCTACAGATGAAGAAAGG - Intergenic
1104348977 12:128028618-128028640 GCAAATCCACAGAGAAAGAAAGG + Intergenic
1104805127 12:131585104-131585126 GCTGATCCAGACGTGAAGAGAGG - Intergenic
1104805148 12:131585218-131585240 GCTGATCCAGACGTGAAGAGAGG - Intergenic
1104805151 12:131585241-131585263 GCTGATCCAGACGTGAAGAGAGG - Intergenic
1105032919 12:132897140-132897162 GAGGATCCACAGAGGAAGAAGGG - Intronic
1107152361 13:37126822-37126844 CCTGAACAACACATGAAGAAAGG + Intergenic
1108093762 13:46879223-46879245 GCTGATCCAGAGAGGCAGAGAGG + Intronic
1110165234 13:72433824-72433846 GTTGATTCTCCGATGAAGAAGGG - Intergenic
1111861636 13:93714730-93714752 GCTTCTCCACAGATGGAGCAAGG + Intronic
1114629386 14:24149420-24149442 GCAGAACCACAGAGGAAGCAGGG - Exonic
1115271336 14:31556912-31556934 GCAGAACCACAGAATAAGAATGG - Intronic
1119169313 14:72521769-72521791 CCTGTTCTACAGATGAGGAAAGG - Intronic
1119511417 14:75214442-75214464 GCTGAGCCACAGGTGGAAAAAGG + Intergenic
1121604956 14:95233895-95233917 GCTGACCCACAGAGGCAGATGGG + Intronic
1121779713 14:96614496-96614518 ACTGATCCACAGATGACGGATGG + Intergenic
1121790889 14:96698859-96698881 GCTGGTCCACAGACTAACAAAGG - Intergenic
1124987433 15:34634614-34634636 GCTGTACTGCAGATGAAGAAAGG - Intergenic
1126341413 15:47645155-47645177 GATGATCCACAGAGGGATAAAGG + Intronic
1126796144 15:52261736-52261758 GCTGGTCAGCAGATGAAAAAAGG + Intronic
1127152875 15:56096187-56096209 AGTGTTCCACAGATCAAGAATGG - Exonic
1131140366 15:89972242-89972264 GCTGAGCCTCAGAAGAAGGAAGG - Intergenic
1135093594 16:19542671-19542693 GATGATCCCCAGAGGTAGAATGG - Exonic
1138655062 16:58486766-58486788 TCTGAACCTCAGAGGAAGAATGG - Intronic
1138851320 16:60633104-60633126 TCTGCCCCACAGATGAAAAATGG - Intergenic
1139338780 16:66253408-66253430 ACTGATACAGAGATGAAAAAAGG - Intergenic
1143840988 17:9731559-9731581 GCTGAATGACAGATGAAGGAAGG + Intergenic
1146567862 17:33928767-33928789 GCAGATCCACAGATGGAGGAGGG + Intronic
1148219579 17:45852024-45852046 TCTCATCCACAGATGAGGAAAGG + Intergenic
1149083983 17:52692455-52692477 GCTGAAGCACAAGTGAAGAAGGG + Intergenic
1149435814 17:56632320-56632342 GCAGATCCACAGTTCCAGAAAGG + Intergenic
1149518323 17:57298217-57298239 CCTGATCCACGGTTGCAGAATGG + Intronic
1150335018 17:64324524-64324546 ACTTACCCACAGAAGAAGAAAGG + Intronic
1152987382 18:333197-333219 TCTGAAACACAGCTGAAGAAAGG - Intronic
1157364437 18:47050879-47050901 GCAGAGGCACAGAGGAAGAAGGG + Intronic
1160688209 19:447257-447279 GCCGATCCACAGAGGCAGGAAGG + Intronic
1161736799 19:5996501-5996523 GCCGATCCACAGAGGCAGGAGGG + Intronic
1164259119 19:23553904-23553926 GAGGAGCCACAGAGGAAGAAGGG - Intronic
1166050041 19:40253511-40253533 ACTCATCCACAGAGAAAGAAAGG + Intronic
1166454140 19:42926397-42926419 CCTGGCCCACAGAGGAAGAAAGG + Intronic
1167704978 19:51076596-51076618 GCAGAGCCAGAGATGAAGAGTGG + Intergenic
1168268046 19:55233137-55233159 GCTGACCCAAAGATGCAGTATGG + Intronic
924965859 2:75978-76000 GATGATCCACAGATTAATGAAGG - Intergenic
925346510 2:3175646-3175668 GCTGCTGCCCAGAAGAAGAAGGG + Intergenic
925885977 2:8394088-8394110 GCTGATCCACAGAAAAAGCAGGG + Intergenic
926963463 2:18385115-18385137 GCTGATTCACAGATGGATGAAGG + Intergenic
929790480 2:45018812-45018834 GGTGATGCACAGCTGCAGAAGGG - Intergenic
931537389 2:63293881-63293903 GCTGATCAACATATGCAGCATGG + Intronic
932781186 2:74559665-74559687 GCTCATTTACAGATGAGGAAAGG - Intronic
937815484 2:126245877-126245899 GGTGAGCCGCAGAAGAAGAAGGG - Intergenic
937869549 2:126777355-126777377 GCTGAACCAGAGAGGAGGAACGG - Intergenic
938321863 2:130371338-130371360 GGTGTTCCAAGGATGAAGAAGGG - Intronic
941492167 2:166155696-166155718 ACTTATCCACAGATCTAGAAGGG - Intergenic
941581197 2:167297710-167297732 ACTTATCCTCATATGAAGAATGG + Intergenic
941801893 2:169669159-169669181 AGAGGTCCACAGATGAAGAATGG + Intronic
945163535 2:206918518-206918540 GCAGATGCACAGATGCATAAGGG - Intergenic
945267093 2:207901260-207901282 CCTGATCCACAGATGATTGAAGG - Intronic
945425605 2:209696530-209696552 TTTGATCCACAGATGATGATAGG + Exonic
1169515020 20:6306892-6306914 GCTGATCCACACAGCAAGGAAGG + Intergenic
1170686855 20:18577086-18577108 GCTGATTCAAAGAAGAAGAAAGG + Intronic
1170777447 20:19390342-19390364 GCTGATCCAGAGATGCTCAATGG + Intronic
1172985387 20:38983475-38983497 GCTGATCAACAGAAGAACTAAGG - Intronic
1173335129 20:42106553-42106575 GCAGTTCCACCAATGAAGAATGG - Intronic
1174095748 20:48088228-48088250 TCTGATCCAGAGAAGTAGAATGG + Intergenic
1178421266 21:32445315-32445337 GCTTATCCACAGATGTGGAATGG - Intronic
1180041055 21:45280352-45280374 GTAGATCCACAGCTGAAGATGGG - Intronic
1182245642 22:28955466-28955488 GCTGATCCACAGAGGCTGCAAGG - Intronic
950554650 3:13688101-13688123 CCTATTCCACAGATGAAGAAGGG + Intergenic
952826558 3:37529777-37529799 GCTGCTCCAGAGATGAGGGATGG + Intronic
953755916 3:45645760-45645782 GCTGAGAGACACATGAAGAAGGG - Intronic
955864119 3:63364002-63364024 GCAGATCCCCTGATGTAGAAGGG + Intronic
957050124 3:75405209-75405231 GCTTATCCACAGATGCGGGACGG + Intergenic
960007933 3:112800174-112800196 CCTGCTTCACAAATGAAGAAAGG - Intronic
961882441 3:130071646-130071668 GCTTATCCACAGATGCAGGACGG + Intergenic
962010676 3:131387518-131387540 CCTGATGCACAGATGCAGATTGG + Intronic
965511635 3:169574236-169574258 GCTGACCTACAGATGAATTATGG + Intronic
968883803 4:3316481-3316503 CCTGTTCCAGTGATGAAGAAGGG + Exonic
972837944 4:42896861-42896883 TCTGAGCCAAAGATGAATAAAGG + Intronic
973122142 4:46534691-46534713 GCTGAACCACAAAAGAAGGAAGG + Intergenic
975489795 4:74976061-74976083 CCTGATCCACAGAAAAAGCATGG - Intronic
975655853 4:76640691-76640713 GCCGTTCTACAGATGGAGAATGG + Intronic
976438921 4:85051020-85051042 GGTGATACATAGATGAAGGAGGG + Intergenic
979749663 4:124263152-124263174 TCTGATATACAGAGGAAGAAAGG - Intergenic
982693720 4:158575979-158576001 GCTGATCCACAGATGACTGCAGG - Intronic
986445115 5:7814811-7814833 GCTAAATCAGAGATGAAGAAAGG - Intronic
988665238 5:33320052-33320074 GCTGAGGCGAAGATGAAGAAGGG + Intergenic
989583266 5:43053333-43053355 GCTCTTCCAAAGATGATGAATGG - Intergenic
992678218 5:79126990-79127012 GAGGAGCCACAGAGGAAGAAAGG + Intronic
992770432 5:80042321-80042343 GCTGATCCACAGATGAAGAACGG - Intronic
993199654 5:84798329-84798351 GATGTTCCTCAGATGAATAAAGG + Intergenic
995180598 5:109227120-109227142 GGTGGCCCACAGATGACGAAGGG + Intergenic
995689259 5:114805171-114805193 GCTGAAGGACAGGTGAAGAAAGG + Intergenic
997306773 5:132843286-132843308 GCAAATCCACAGAGAAAGAAGGG + Intergenic
997477187 5:134150400-134150422 CCTGTTCCAGAGAGGAAGAAAGG + Exonic
997626403 5:135334094-135334116 CCCGTTCCACAGATGAAGGAGGG - Exonic
997668255 5:135649474-135649496 GGTGAACCACAGTTGAAGAAGGG + Intergenic
998522043 5:142809965-142809987 TCTTATCCACAGCTGTAGAAAGG - Intronic
998614938 5:143729596-143729618 GCTGTGTCTCAGATGAAGAAAGG + Intergenic
999046583 5:148476170-148476192 ACTGAGCCAGAGATGTAGAATGG - Intronic
999321592 5:150618633-150618655 GCTGCTCCAGAGAGGAACAAGGG + Exonic
1000258779 5:159565965-159565987 CCTGAAACACAGATCAAGAAGGG + Intergenic
1005099307 6:22152827-22152849 CCTGGCACACAGATGAAGAATGG - Intergenic
1008129703 6:47706688-47706710 CCTGTTACAGAGATGAAGAATGG + Intronic
1009318387 6:62253615-62253637 ACTGACACACAGAAGAAGAAGGG + Intronic
1009767110 6:68092913-68092935 TATGATCCACAAATTAAGAATGG - Intergenic
1009879188 6:69544084-69544106 ACTCATCCACAGGTGATGAAAGG + Intergenic
1014620221 6:123658481-123658503 GTAGATCCACAGGGGAAGAATGG + Intergenic
1015220354 6:130797188-130797210 GCTGCTCCACAGACAAAGCAGGG + Intergenic
1016029839 6:139325916-139325938 GCCGTTCCACAGAGGAAGGAGGG - Intergenic
1017690125 6:156955940-156955962 GCAGATACACAGATGAACACAGG - Intronic
1023338647 7:39196198-39196220 GTAGATCTACAGCTGAAGAAAGG + Intronic
1023677873 7:42649792-42649814 GCAGATCAGCAGATGAAGACAGG + Intergenic
1026375992 7:69751595-69751617 GCTAAACCACTGATGAATAAAGG - Intronic
1027552131 7:79612282-79612304 ACTGATCCACAGATGCAAGAGGG + Intergenic
1028343762 7:89755042-89755064 GCTGATCCAGGCATGAAGAACGG + Intergenic
1031089602 7:117338609-117338631 GTTGTTCCACAGATGAAGATTGG - Intergenic
1034168127 7:149041509-149041531 GCTGAGTCACAGCTGAAGACTGG - Intergenic
1036071959 8:5450704-5450726 GCTGTTCAACAGATGAATGAAGG + Intergenic
1037659133 8:20912132-20912154 GCTGATATAAAGAAGAAGAAAGG - Intergenic
1038272081 8:26083269-26083291 GCTGGTACACAGAAGATGAAAGG + Intergenic
1039516245 8:38136393-38136415 TATGATCCAAACATGAAGAAGGG + Intronic
1039853957 8:41396773-41396795 GCTGATCAAGAGAGTAAGAAGGG + Intergenic
1041183705 8:55275560-55275582 GATGATCCAGTTATGAAGAAAGG - Intronic
1043231178 8:77803317-77803339 GCTTATTCACAGATGGAGCACGG + Intergenic
1048142086 8:131804477-131804499 GCTGCCCCACAGATAAAGACAGG - Intergenic
1049956408 9:696934-696956 ATTGATGCACAGATGAAGAAAGG + Intronic
1050425522 9:5508999-5509021 GCAGATCCCCAGAGGAAGCACGG + Intergenic
1050891498 9:10830077-10830099 GCTGAAACACACATGCAGAATGG + Intergenic
1052565176 9:30140657-30140679 GCTGCTCCACAGACAAAGCAGGG - Intergenic
1053131050 9:35615945-35615967 GCTGAGCCGCATGTGAAGAAGGG + Exonic
1054846127 9:69800284-69800306 GCTGATAAACACATGAACAAAGG - Intergenic
1057853516 9:98583879-98583901 GCTGGTCCACAGGAAAAGAAGGG - Intronic
1058054784 9:100438507-100438529 TCTGATTCACAAATGAAAAAAGG - Intronic
1059336375 9:113571481-113571503 GCTAATCAACACATGAAAAAGGG - Intronic
1060493980 9:124104609-124104631 GTGGATCCACTGATGCAGAAAGG - Intergenic
1062034185 9:134375514-134375536 GCTGACCCTCAGATGAACCAGGG - Intronic
1062593617 9:137287275-137287297 GCTCATCCTCAGAGGCAGAAGGG - Intergenic
1186933204 X:14417716-14417738 GCTAATCCATAGATGCAGACAGG + Intergenic
1192135659 X:68597226-68597248 GTTCACCAACAGATGAAGAAAGG + Intergenic
1197643800 X:128995469-128995491 GCTGAGCCCCAAATGAAGGATGG + Intergenic
1199068549 X:143449229-143449251 GCTTATTTACAGCTGAAGAAAGG - Intergenic
1200507769 Y:4035870-4035892 GCTGAGCCCCAGATAAAGACAGG + Intergenic
1201652958 Y:16311348-16311370 GCTGATGCAGAGATGAAGTGAGG + Intergenic
1201723607 Y:17131376-17131398 GAAGAGCCACAGAGGAAGAAGGG + Intergenic