ID: 992779356

View in Genome Browser
Species Human (GRCh38)
Location 5:80114027-80114049
Sequence GGGCAGGTCATTGTTAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992779356_992779366 25 Left 992779356 5:80114027-80114049 CCTCAATTAACAATGACCTGCCC 0: 1
1: 0
2: 0
3: 12
4: 116
Right 992779366 5:80114075-80114097 CCATGCTAAGTTACAAGGAGTGG No data
992779356_992779367 26 Left 992779356 5:80114027-80114049 CCTCAATTAACAATGACCTGCCC 0: 1
1: 0
2: 0
3: 12
4: 116
Right 992779367 5:80114076-80114098 CATGCTAAGTTACAAGGAGTGGG 0: 1
1: 0
2: 1
3: 8
4: 111
992779356_992779364 20 Left 992779356 5:80114027-80114049 CCTCAATTAACAATGACCTGCCC 0: 1
1: 0
2: 0
3: 12
4: 116
Right 992779364 5:80114070-80114092 CGTCTCCATGCTAAGTTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992779356 Original CRISPR GGGCAGGTCATTGTTAATTG AGG (reversed) Intronic
907455473 1:54572590-54572612 GGGCGGGTCATTCATACTTGGGG + Intronic
908606759 1:65805936-65805958 GTGCAGGTCATTTCTAATTTTGG + Intronic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
909610318 1:77545126-77545148 GTGAAGGGCATTGTTAATTGCGG - Intronic
912448071 1:109752325-109752347 TGGCAGGTCAGTGTTAGGTGGGG + Intronic
913273918 1:117120089-117120111 GGGCTGGTAGGTGTTAATTGGGG - Intronic
913320309 1:117583273-117583295 GGGCAGGGCCTTGTTCATTGCGG - Intergenic
913362304 1:117995166-117995188 GGGTAGGTAATGGTTAATTAAGG - Intronic
923301362 1:232643589-232643611 GGGCAGGTCACTGTGTACTGGGG + Intergenic
923417971 1:233783608-233783630 TGGGTGGTCAGTGTTAATTGAGG - Intergenic
923604329 1:235429465-235429487 GGGGAGGTGATATTTAATTGGGG + Intronic
1064008266 10:11714972-11714994 GGGCAGGTCATAGCTAAGTCTGG + Intergenic
1064201540 10:13288975-13288997 GGACAGGTCATTGTTTTTTCAGG - Intronic
1067370567 10:45678394-45678416 GGGGAGGGCATTGTGAAGTGTGG + Intergenic
1067389214 10:45847762-45847784 GGGGAGGGCATTGTGAAGTGTGG - Intronic
1067416858 10:46109196-46109218 GGGGAGGGCATTGTGAAGTGTGG + Intergenic
1067445043 10:46336787-46336809 GGGGAGGGCATTGTGAAGTGTGG + Intergenic
1067502259 10:46816079-46816101 GGGGAGGGCATTGTGAAGTGGGG + Intergenic
1067592329 10:47523941-47523963 GGGGAGGGCATTGTGAAGTGTGG - Intronic
1067639445 10:48032014-48032036 GGGGAGGGCATTGTGAAGTGTGG - Intergenic
1067874050 10:49988291-49988313 GGGGAGGGCATTGTGAAGTGTGG + Intronic
1067918469 10:50426933-50426955 ATGGAGTTCATTGTTAATTGGGG - Intronic
1070136432 10:73698164-73698186 GGGGAGGGCATTGTGAAGTGTGG - Intergenic
1071201518 10:83223993-83224015 GGGCAGGTTATAGGTAGTTGAGG + Intergenic
1074404494 10:113169352-113169374 GGCCAGATAATTGTTAGTTGTGG + Intergenic
1075122291 10:119672868-119672890 GGGCTGATCATTGTGCATTGCGG + Intronic
1077121161 11:909295-909317 GGGAAGGTCATTGGCATTTGGGG - Intronic
1080159709 11:29159228-29159250 TGGTAGGTCAGAGTTAATTGTGG + Intergenic
1080463195 11:32473562-32473584 GGGCAGGTCAATGCAAACTGAGG - Intergenic
1081546199 11:44073676-44073698 GGCCAGGTCATTCTTCATTGTGG - Intronic
1088371264 11:109090792-109090814 GGGCAGGTGATTGTCTATTCTGG + Intergenic
1090442332 11:126734869-126734891 GGGGAGGACAGTGTTAATTGTGG + Intronic
1090617172 11:128525644-128525666 AGACAGGTTGTTGTTAATTGAGG - Intronic
1091589872 12:1836637-1836659 GGGGAGGGCATTGTCAATGGTGG + Exonic
1094261081 12:28500460-28500482 GGGCACCTCATTTTTCATTGAGG + Intronic
1095948658 12:47768527-47768549 GGGCATGTCTTTGTTTACTGTGG - Intronic
1102609599 12:114099767-114099789 GGGCAGGTCATGGGTAGTTTAGG + Intergenic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1104744132 12:131200402-131200424 AGGGAGGTCATTTTTCATTGTGG + Intergenic
1106371619 13:29139931-29139953 GGGCAGGTGATGATTAATAGAGG - Intronic
1106801521 13:33261310-33261332 GGCCAGGTAATTGTTTTTTGTGG - Intronic
1109187361 13:59286163-59286185 GGTTAGGTCATTCTTTATTGTGG - Intergenic
1113737063 13:112686504-112686526 GGGTAGGTCCTGGTTATTTGAGG + Intergenic
1115442469 14:33452227-33452249 GGGCTGGGCATTGTTAAAGGAGG + Intronic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1119853937 14:77885457-77885479 GGGCAGGTTGTTGATAAATGGGG + Intronic
1120334424 14:83135297-83135319 CTGCAGTGCATTGTTAATTGAGG + Intergenic
1120802064 14:88701300-88701322 GGGCAGGTAATTATTTGTTGTGG - Intronic
1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1123870931 15:24571872-24571894 GGGCAGATCAATGCAAATTGAGG + Intergenic
1128645913 15:69378909-69378931 GGCCAGATCATTGTTTGTTGTGG - Intronic
1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG + Intronic
1131878544 15:96837629-96837651 GCTCATGTAATTGTTAATTGTGG + Intergenic
1134827427 16:17295820-17295842 GGCCAGATCATTCTTAGTTGTGG - Intronic
1138814856 16:60192164-60192186 GGGCAGGATATTTTTATTTGGGG + Intergenic
1139599781 16:67979750-67979772 GGGCAGGTCATTGTGGCTGGGGG + Exonic
1139668615 16:68475779-68475801 GAGATGGTCATTGTTGATTGTGG - Intergenic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1146921647 17:36716698-36716720 GGTGAGGTTAGTGTTAATTGCGG + Intergenic
1151621072 17:75245341-75245363 GGGCTGGTCATTCTTCGTTGTGG + Intronic
1160451133 18:78966563-78966585 GGGCAGGTCATTCTTCATGGTGG - Intergenic
1161635691 19:5387523-5387545 AGGGAGGTCATTGTCAAGTGCGG + Intergenic
1162225470 19:9217835-9217857 GGCCGGATCATTGTTAATTAGGG + Intergenic
1164404933 19:27936351-27936373 GGGCAGGGCATTGTGAACTGTGG + Intergenic
1168478191 19:56693402-56693424 GGACAGGTCATCGTCAATGGTGG - Intergenic
925515831 2:4680491-4680513 TGACAGGTCATTTTTATTTGTGG - Intergenic
929678057 2:43957917-43957939 GTGCAGGTCATTGATCATAGTGG - Intronic
930906585 2:56576094-56576116 GGGCAGGTCATAGTCCTTTGGGG - Intergenic
931777068 2:65549920-65549942 GGACAGGTAATTCTTTATTGTGG - Intergenic
933036332 2:77403644-77403666 TGGCAGGTCTTAGCTAATTGAGG + Intronic
933665062 2:84958182-84958204 GGGCAGGTGATGGTAAATAGAGG - Intergenic
936076484 2:109404814-109404836 GGACAGGGCATTGGTAACTGTGG - Intronic
946748216 2:222866725-222866747 GGGCAGGGCAGTTTTATTTGGGG - Intronic
948380017 2:237544562-237544584 GGGGGGGACATTGTTTATTGGGG + Intronic
1173982592 20:47236380-47236402 GGGCAGGTCAGCGTTGACTGAGG + Exonic
1178767647 21:35469289-35469311 GGGCAGGTTGTTATTAATCGTGG + Intronic
949340625 3:3026718-3026740 AGGCACGTCATTGTGAATTTAGG + Intronic
952496194 3:33917802-33917824 GGGCAGCCCACTGTAAATTGTGG - Intergenic
959770636 3:110090911-110090933 GGGCAAGTCAATGCAAATTGAGG + Intergenic
960879447 3:122329902-122329924 GGGCAGATAAGTGATAATTGGGG - Intronic
961048758 3:123728540-123728562 GGGCAGGGTATTGTTGTTTGGGG - Intronic
966900557 3:184481051-184481073 GGGTAGGTGATTGTGACTTGTGG + Intronic
969218466 4:5743014-5743036 GGGCAGTTCATTGCAAATTGAGG + Intronic
970756189 4:19429324-19429346 GGGCAGGCCATGGGTAATTTAGG + Intergenic
971354093 4:25878890-25878912 GGGCATGTCATTCTTGGTTGTGG - Intronic
979300671 4:119082943-119082965 GGTGAGGTCACTGTCAATTGAGG + Intergenic
983539197 4:168890340-168890362 GGGTAGGCCAATGTTATTTGAGG - Intronic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
987051410 5:14149496-14149518 GGGCAGGTGATTAGTAATTTGGG - Intronic
987280947 5:16413039-16413061 GGGCAGTTAATTGTTATTTATGG + Intergenic
992779356 5:80114027-80114049 GGGCAGGTCATTGTTAATTGAGG - Intronic
993170469 5:84412887-84412909 GAGCTGGTTATTGTTAATTATGG + Intergenic
995262162 5:110116789-110116811 TGTCAGGTCATTATTTATTGTGG - Intergenic
997452791 5:133996882-133996904 GTGGAGGTCATTGCTAGTTGAGG - Intronic
1001704443 5:173731629-173731651 GGCCAGGTCATTCTTTGTTGTGG - Intergenic
1007246089 6:40463961-40463983 AGGCAGGTCATTGTTCAAGGTGG - Intronic
1010616605 6:78020566-78020588 GGGCAGGTTAATATGAATTGAGG - Intergenic
1010865954 6:80976978-80977000 GGGCAGGTCAATGCAAATTGAGG - Intergenic
1010866606 6:80983337-80983359 GGGAAGGTCAATGCAAATTGAGG - Intergenic
1013062767 6:106653295-106653317 GGGCTGGTAATTGTTTGTTGTGG + Intronic
1016464017 6:144308292-144308314 GACCAGGTCATTGTTTATGGTGG + Intronic
1016519575 6:144931464-144931486 AGGCAGGTCAATGCAAATTGAGG + Intergenic
1022268263 7:28780281-28780303 TGGCAGGGCATTGTTTGTTGGGG - Intronic
1026192364 7:68141145-68141167 GGGCAAGCCATTGGTATTTGGGG - Intergenic
1028192628 7:87870574-87870596 GGGCAGGTCATAGGTAGTTTTGG - Intronic
1030316961 7:108125958-108125980 GGGCAGGTCATTTTTAAACCTGG - Intronic
1033175423 7:139119134-139119156 GGTGAGGTCACAGTTAATTGGGG - Intergenic
1039157654 8:34579691-34579713 TGGCAGATCAATGTAAATTGAGG - Intergenic
1040068682 8:43170968-43170990 GGGCAAGTCGCTGTTACTTGGGG + Intronic
1045427882 8:102085169-102085191 GGCCAGGTAATTGTTTGTTGTGG + Intronic
1047857424 8:128926794-128926816 GGTCAGGTCATTGTCAATTAGGG - Intergenic
1051334051 9:16050715-16050737 GGACAGCTCTTTGTTTATTGAGG - Intronic
1052394146 9:27917280-27917302 ATGCAGGTCTTTGTTAATTCTGG + Intergenic
1052660149 9:31419174-31419196 GGGCAGGCCATAGTTAGTTTTGG - Intergenic
1054799728 9:69335365-69335387 GGGCAGGTGACTGCTAAATGGGG + Intronic
1057566152 9:96167668-96167690 GGGCAGGTAATTCTTTGTTGTGG + Intergenic
1061340442 9:129976212-129976234 GGCCAGGTCATTCTTCGTTGGGG + Intronic
1186817973 X:13256569-13256591 GGGCTGGCCATTCTTAGTTGTGG - Intergenic
1186962667 X:14753709-14753731 TGGGAGGTCTTTGTTCATTGGGG - Intergenic
1187051472 X:15700732-15700754 GGGCAGATCATTCTTGGTTGTGG + Intronic
1187540418 X:20187776-20187798 GGGAAGGAGATTGTTAAGTGAGG - Intronic
1189429464 X:40934207-40934229 GGGCAGAGAATTGTTAAGTGTGG + Intergenic
1189743626 X:44147037-44147059 GGCCATTTCATTGCTAATTGTGG + Intergenic
1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1194175868 X:90647960-90647982 GGGCATGTCAGTGTTTTTTGTGG + Intergenic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1195574282 X:106432394-106432416 GGTCAGGTAATTCTTGATTGTGG + Intergenic
1198441367 X:136666612-136666634 GGGAAGGTCACTGGAAATTGAGG - Exonic
1200522505 Y:4228921-4228943 GGGCATGTCAGTGTTTTTTGTGG + Intergenic