ID: 992780695

View in Genome Browser
Species Human (GRCh38)
Location 5:80124437-80124459
Sequence AAACAAAGCCTACTATAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 141}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992780695_992780697 -10 Left 992780695 5:80124437-80124459 CCTCTCTATAGTAGGCTTTGTTT 0: 1
1: 0
2: 0
3: 14
4: 141
Right 992780697 5:80124450-80124472 GGCTTTGTTTGTTCTTATTTGGG 0: 1
1: 1
2: 10
3: 82
4: 747
992780695_992780700 28 Left 992780695 5:80124437-80124459 CCTCTCTATAGTAGGCTTTGTTT 0: 1
1: 0
2: 0
3: 14
4: 141
Right 992780700 5:80124488-80124510 TCCACAGTCCTTGTTTTTCAGGG 0: 1
1: 0
2: 2
3: 32
4: 315
992780695_992780699 27 Left 992780695 5:80124437-80124459 CCTCTCTATAGTAGGCTTTGTTT 0: 1
1: 0
2: 0
3: 14
4: 141
Right 992780699 5:80124487-80124509 TTCCACAGTCCTTGTTTTTCAGG 0: 1
1: 0
2: 0
3: 41
4: 344
992780695_992780698 -7 Left 992780695 5:80124437-80124459 CCTCTCTATAGTAGGCTTTGTTT 0: 1
1: 0
2: 0
3: 14
4: 141
Right 992780698 5:80124453-80124475 TTTGTTTGTTCTTATTTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992780695 Original CRISPR AAACAAAGCCTACTATAGAG AGG (reversed) Intronic
904342789 1:29848348-29848370 AAACAAAGGATACTCTACAGTGG - Intergenic
905292637 1:36933102-36933124 GAACAAAGCCTACACTAAAGCGG + Intronic
906043587 1:42809374-42809396 CAACCAAACCTACAATAGAGAGG + Intronic
906088684 1:43158361-43158383 AACCAAACCCTACTATATATTGG - Intergenic
906831471 1:49036225-49036247 CAAAAAAATCTACTATAGAGAGG + Intronic
907202718 1:52741614-52741636 AAACAATGCCTACTACATAGTGG - Intronic
908091411 1:60689467-60689489 AAACAAATCCCACTAAAAAGTGG + Intergenic
908116083 1:60941572-60941594 AAAACATGCCGACTATAGAGAGG + Intronic
910581352 1:88828954-88828976 AAGAAAAGCCCACTATAGATTGG + Intronic
911541204 1:99160876-99160898 AAACCAAACCTACAATAGATTGG - Intergenic
912052541 1:105548171-105548193 AAACAAAGCCTGTTATATAATGG - Intergenic
916324250 1:163539452-163539474 AAAGATAGCCATCTATAGAGAGG - Intergenic
916426206 1:164683033-164683055 AAAGAAAGCCTCCAAGAGAGTGG + Intronic
916761553 1:167822133-167822155 AAACAAAACCTAAGAGAGAGAGG + Exonic
917028843 1:170668039-170668061 AAAGAAAGCATTCTACAGAGAGG - Intronic
918382661 1:183972046-183972068 AAACAAAACCAAATATAAAGGGG + Intronic
918950353 1:191127897-191127919 AATCAAAGGCAACTATAGAGAGG + Intergenic
919137843 1:193533000-193533022 GACCAGGGCCTACTATAGAGTGG + Intergenic
923088934 1:230723463-230723485 AAGCAAAGCCTATTACAAAGAGG - Intergenic
924219541 1:241858936-241858958 AAACAAAGACTAGTATAAAGAGG + Intronic
1065047987 10:21761235-21761257 AATAAAAGCCTACTATAAAGAGG - Intronic
1066054406 10:31667014-31667036 AAACACAGCCTGGTATAAAGGGG + Intergenic
1068093043 10:52456252-52456274 AAACATACCCTACAGTAGAGAGG + Intergenic
1069087648 10:64160142-64160164 CAAAAAAGCCAACTATAGGGAGG + Intergenic
1069150343 10:64952486-64952508 AAACAAAGCATCATATAGAAAGG - Intergenic
1070817746 10:79335931-79335953 ACACAAGGCCTCCTATACAGTGG + Intergenic
1077872560 11:6274354-6274376 AAACAAAGCCTTCTGTAGACAGG + Intergenic
1078051272 11:7967045-7967067 ATACAAAGCCTCCCATAGAGAGG + Intergenic
1078387430 11:10904772-10904794 AATCAACGTCTACTTTAGAGTGG + Intergenic
1079566845 11:21892855-21892877 AAAAAAAACCTCCTATTGAGCGG + Intergenic
1080629631 11:34062002-34062024 AAACAAAGACTATTAAACAGTGG - Intronic
1081292697 11:41346170-41346192 AAACAAAGCACATTAAAGAGAGG + Intronic
1086834884 11:91608539-91608561 AAAGAAAGCCTCCTGTAAAGTGG - Intergenic
1087071683 11:94087952-94087974 AAACAGAGGCTACTAGAGAAAGG + Intronic
1088937632 11:114419634-114419656 GCACAAAGCCTACTATTCAGAGG + Intronic
1095645590 12:44542276-44542298 AAAAAAAGACTAATATATAGAGG - Intronic
1096954671 12:55513984-55514006 AAAGAAAGCCTACTCTATTGTGG + Intergenic
1099030639 12:77522245-77522267 AAACAAAGCTTCCAATAGACAGG + Intergenic
1100366658 12:93927644-93927666 ATTAAAAGCCTACTATAGACCGG + Intergenic
1107151697 13:37119011-37119033 AAAAAAAGCCATCTAAAGAGAGG - Intergenic
1107542549 13:41404784-41404806 AAAAAAAGCCCACTATAGAATGG + Intergenic
1110671085 13:78178855-78178877 AAACAAAACCCACTAAAAAGTGG - Intergenic
1110796252 13:79641759-79641781 AAACAAAGACTATTTTAGATGGG + Intergenic
1115322752 14:32101987-32102009 AAAAAAAGCTTACTATAGGAAGG + Intronic
1115930629 14:38488628-38488650 AAATAAATTCTACTAGAGAGAGG - Intergenic
1130694768 15:86120068-86120090 AAACAAAGCCTCAAATATAGAGG + Intergenic
1131750240 15:95498458-95498480 AAACAAATCCATGTATAGAGAGG + Intergenic
1135050265 16:19186784-19186806 AAACAAAGAATAATAAAGAGGGG - Intronic
1135913488 16:26582124-26582146 AAAGAAAGTCCATTATAGAGCGG - Intergenic
1137465613 16:48706206-48706228 AAACAAAGCTTAGTATATAGTGG + Intergenic
1138820617 16:60254679-60254701 AAAAAAAGCTTACTATATAAAGG - Intergenic
1139060615 16:63246059-63246081 AAACAAAGCATAGAAAAGAGGGG + Intergenic
1141057515 16:80832332-80832354 AAAAAAAACCTACTATAGAATGG + Intergenic
1143596099 17:7915256-7915278 AAACAAAGCCTACGTTACCGTGG - Intergenic
1149137333 17:53383501-53383523 AAACAAAGCCTCCTTTATACAGG + Intergenic
1149771784 17:59328273-59328295 AAAAAAAGCCTCCTCCAGAGAGG - Intergenic
1150484175 17:65532644-65532666 ATACAAGGCCTGCTCTAGAGGGG + Intronic
1150832446 17:68536390-68536412 AAACAAAGCCTCCTATTAAAAGG + Intronic
1153933637 18:9901313-9901335 AAACAAAGTTTACTAATGAGTGG + Intergenic
1157066399 18:44355859-44355881 AAACAAAGCCTACAAAATATGGG - Intergenic
1159412006 18:68090048-68090070 AAATAAAGGCTGCTATAGTGTGG + Intergenic
1166339107 19:42126848-42126870 AAACAGAGACTGCTAAAGAGAGG - Intronic
1167961212 19:53105608-53105630 AAAAAAAGCCTACTCTTGGGAGG + Intergenic
925715529 2:6781332-6781354 AAACAAAGGCTGCTAAAGAAGGG + Intergenic
925870268 2:8264243-8264265 AAACAAAACCCACTAAAGAAGGG + Intergenic
926565871 2:14473152-14473174 AAATAAAGCCTACTTGATAGTGG - Intergenic
929022669 2:37568997-37569019 AAACACAGTCTACAATAGATTGG + Intergenic
929589208 2:43134300-43134322 CAACAAGGCCTAGTATAGATAGG + Intergenic
933314157 2:80695968-80695990 AAACAAAACCTACTATTTAAGGG + Intergenic
935494298 2:103759495-103759517 AAACAAACCTTTTTATAGAGTGG - Intergenic
936376046 2:111942299-111942321 AAACCAAGGCTACTGAAGAGGGG - Intronic
938776726 2:134547653-134547675 AACCAAAGCCAACAATATAGAGG + Intronic
939451341 2:142378787-142378809 AAACACAGCCTACTTTAGCAAGG - Intergenic
939748269 2:146005775-146005797 AAACAAAAACTACTAAAGAGTGG + Intergenic
941663354 2:168217892-168217914 AAACATAGTCTCCTATGGAGGGG + Intronic
943855806 2:192788646-192788668 TAACAAAGCCTACTTCAGTGTGG - Intergenic
947170655 2:227307853-227307875 AAAGAAAACCCACTGTAGAGTGG - Exonic
1171301962 20:24070380-24070402 CAACAAAGCATTCTATAAAGAGG - Intergenic
1171484477 20:25477185-25477207 AAAGAAAGCCAACCACAGAGAGG - Intronic
1177432129 21:21003591-21003613 AAACAAAGCCTAGCATAGTAGGG - Intronic
1178686777 21:34717904-34717926 AAACAAAGTCTTTAATAGAGTGG + Exonic
1183682965 22:39344885-39344907 AGACAAAGCCTAATGTAGGGTGG + Intergenic
1184524404 22:45013271-45013293 GAAGAATGCCTACTACAGAGGGG - Intergenic
951603826 3:24409262-24409284 AAACCAAGACTCCTATAGAGTGG - Intronic
951607328 3:24450716-24450738 AAGCTGAGCCTACTATAGATTGG - Intronic
953630399 3:44610862-44610884 ATACAAAGCCTAGGAAAGAGGGG + Intronic
954307255 3:49735056-49735078 AAAAAAAGCCCACTCTAGACTGG + Intronic
954550620 3:51478354-51478376 ATGCAAAGCCTAAAATAGAGGGG - Intronic
956719358 3:72104253-72104275 AAACAAAGCCATGTAGAGAGTGG - Intergenic
959491349 3:106992313-106992335 AAACATACCCAACTATATAGTGG + Intergenic
962163023 3:133019722-133019744 TAACAAAGCCACCCATAGAGTGG + Intergenic
962391835 3:134978644-134978666 AAGCAAGGCCTACTACAGACAGG - Intronic
965224090 3:165965260-165965282 CAACAAAATCTACTATTGAGGGG - Intergenic
966801797 3:183771045-183771067 AAACAATTCCTACTATACGGGGG + Intronic
967105684 3:186253272-186253294 AAACAAAGAATGCTATGGAGGGG - Intronic
968930032 4:3573811-3573833 AAACACAGCCTCCTCAAGAGAGG - Intergenic
970952589 4:21774572-21774594 AGACAAAACCTACGATTGAGTGG - Intronic
973984871 4:56340828-56340850 AAACAAATCCTATTAAAAAGTGG + Intronic
974195027 4:58563055-58563077 AAACAAAACTTACTAAAAAGTGG - Intergenic
975372979 4:73609682-73609704 CAACAATGCCTAGTAAAGAGAGG + Intronic
976155212 4:82136675-82136697 ACACAAAGCCTATTTTATAGTGG - Intergenic
976839510 4:89414929-89414951 ATACAAAGCTTAGTATACAGTGG - Intergenic
977442210 4:97082441-97082463 GAATAAAGCCTACTTGAGAGTGG + Intergenic
977977918 4:103288181-103288203 AAACAGACCCTGCTATAAAGAGG - Intergenic
981123765 4:141082535-141082557 AAACATAGCCTAATATAGCAGGG + Intronic
981345235 4:143667832-143667854 AAGAAAATCCTACTAAAGAGAGG - Intronic
986820116 5:11457549-11457571 AAAAAATGCCAACTATGGAGTGG - Intronic
988205799 5:28132168-28132190 AAACAATGTGTACTCTAGAGAGG - Intergenic
989500664 5:42163382-42163404 AAACAAAACCTATTAAAAAGTGG - Intergenic
990720558 5:58690763-58690785 AAAAAAAGCAGACTATAGAAAGG + Intronic
991170895 5:63624497-63624519 AAATCAAGCCTACTAGAGAAGGG - Intergenic
991557091 5:67907816-67907838 TAATAAAGCCTGCTATATAGGGG + Intergenic
992738793 5:79751791-79751813 AAACAAAGCCTAGTGAAGAATGG + Intronic
992780695 5:80124437-80124459 AAACAAAGCCTACTATAGAGAGG - Intronic
994450536 5:99935918-99935940 AAACAAACCATACTATATATTGG + Intergenic
994741280 5:103622895-103622917 TACCACAACCTACTATAGAGAGG - Intergenic
995156896 5:108925574-108925596 AAAGAAAGCCTAAAAAAGAGAGG - Intronic
996612316 5:125397016-125397038 AAACAAAGACTGTTATGGAGGGG - Intergenic
1007667711 6:43525316-43525338 AAACAAACCCATCTTTAGAGGGG - Intronic
1009427779 6:63533542-63533564 AAACAACGCATACTATAGTTTGG - Intronic
1011530719 6:88318061-88318083 AAACAATGTCTTCTATAAAGGGG + Intergenic
1012741024 6:103017157-103017179 AGACCAAGCCTACTATTGATTGG - Intergenic
1013328185 6:109069281-109069303 AAAACAAGCCTCCTAGAGAGGGG + Intronic
1016427863 6:143953658-143953680 AAACACAGCCTAATATAAAAGGG + Intronic
1016538581 6:145137182-145137204 ATACAAATTCTACTATAGTGTGG - Intergenic
1017489568 6:154933144-154933166 AAACACAGCCTAATAAAGGGGGG - Intronic
1025217772 7:57073172-57073194 AAAAAAATCCTATAATAGAGAGG + Intergenic
1025653579 7:63497290-63497312 AAAAAAATCCTATAATAGAGAGG - Intergenic
1028490263 7:91403670-91403692 TGAAAAAGCCTACTATAGACAGG + Intergenic
1028721917 7:94042695-94042717 AAACAACCCTTGCTATAGAGAGG - Intergenic
1028761455 7:94501710-94501732 AAAAAAAACCCACTAAAGAGTGG + Intergenic
1028835398 7:95369337-95369359 AAACAAAGAATACTAGAGTGGGG + Intronic
1028928886 7:96390961-96390983 AAACAGAGCCTGCTACAGAGTGG + Intergenic
1031400902 7:121325471-121325493 AAACAAAACCCACCATAGGGAGG - Intronic
1033904139 7:146180633-146180655 CAACAGTGCCTAGTATAGAGAGG - Intronic
1037238929 8:16755140-16755162 TTACAAAGCCTACTCTGGAGAGG + Intergenic
1038907454 8:31921885-31921907 TAACAAAGTCTCATATAGAGGGG - Intronic
1043159386 8:76826934-76826956 AAACAAAGGCTATTATTGGGTGG + Intronic
1047041652 8:121003711-121003733 TCTCAAAGCCTACTATAGATAGG + Intergenic
1048658196 8:136566919-136566941 GAATAAAGCCTACTTTATAGTGG - Intergenic
1048838312 8:138542350-138542372 AAACAATGCCTGGTACAGAGAGG + Intergenic
1054460046 9:65457969-65457991 AAACACAGCCTCCTCAAGAGAGG + Intergenic
1057408440 9:94794792-94794814 AAACAGAGCCTACAAAACAGAGG + Intronic
1061072207 9:128317841-128317863 ACACAATGCCTAGTACAGAGTGG + Intronic
1189677212 X:43473612-43473634 AAAACATGCCGACTATAGAGAGG + Intergenic
1190378976 X:49819584-49819606 AAAAAAAGACAACTATAGACTGG - Intergenic
1194597504 X:95876924-95876946 AAACAAAGTCTACTATGGGCTGG + Intergenic
1195392780 X:104380235-104380257 CAACAAAGCCAACTATAGAATGG - Intergenic
1195629267 X:107037188-107037210 AAAAAAATCCTACTACAGACTGG + Intergenic
1196357646 X:114812255-114812277 AAAGAAAGCATTATATAGAGTGG + Intronic
1196413260 X:115442790-115442812 AAATGAAACCTACTAAAGAGAGG - Intergenic
1196549065 X:116999558-116999580 AACGAAAGCCTTCAATAGAGTGG + Intergenic
1197297118 X:124732563-124732585 AAACACAGCCTGCTATAAAAGGG + Intronic
1198968368 X:142251334-142251356 AAACAAAGTGTTCTTTAGAGCGG + Intergenic
1199197812 X:145052494-145052516 AGACAAAGCCTACTTGAGTGTGG - Intergenic
1200893645 Y:8351031-8351053 AAACAAAGACTACTAAAGTGTGG + Intergenic