ID: 992782493

View in Genome Browser
Species Human (GRCh38)
Location 5:80140852-80140874
Sequence GCTGCTGGTCAGACACATTT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992782493_992782499 20 Left 992782493 5:80140852-80140874 CCTAAATGTGTCTGACCAGCAGC 0: 1
1: 1
2: 1
3: 15
4: 167
Right 992782499 5:80140895-80140917 GGTCATGTACAAAAAGGTGTAGG 0: 1
1: 0
2: 1
3: 9
4: 128
992782493_992782498 14 Left 992782493 5:80140852-80140874 CCTAAATGTGTCTGACCAGCAGC 0: 1
1: 1
2: 1
3: 15
4: 167
Right 992782498 5:80140889-80140911 TCTTTAGGTCATGTACAAAAAGG 0: 1
1: 0
2: 0
3: 9
4: 183
992782493_992782497 -1 Left 992782493 5:80140852-80140874 CCTAAATGTGTCTGACCAGCAGC 0: 1
1: 1
2: 1
3: 15
4: 167
Right 992782497 5:80140874-80140896 CTTCTGGGAATATACTCTTTAGG 0: 1
1: 0
2: 0
3: 15
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992782493 Original CRISPR GCTGCTGGTCAGACACATTT AGG (reversed) Exonic
905036579 1:34922328-34922350 GCTGTTGGGAAGACACTTTTGGG + Intronic
907386576 1:54129439-54129461 GCTGCAGGTCAGGCAGACTTGGG - Intergenic
912115269 1:106398955-106398977 GATGCTGGTAATACACATTTTGG - Intergenic
918642257 1:186857043-186857065 GCTGCATGGCAGACACATGTGGG - Intronic
920032286 1:203044689-203044711 GCTGCAGGGCAGACACCTGTAGG - Intronic
920050244 1:203160254-203160276 ACTTCTGGTCCCACACATTTTGG - Intronic
1063451169 10:6151262-6151284 GCTGCTCTTCAGACACCTTGTGG - Intronic
1064143150 10:12806952-12806974 GCTGCTGGCCAAACACATCATGG + Intronic
1065241151 10:23706785-23706807 ACTGCTGTTCAGGCACTTTTGGG + Intronic
1067136970 10:43618168-43618190 GTTGGTGCTCAGACAAATTTTGG - Intergenic
1067676377 10:48382207-48382229 TCTGCTGGTCAGAAAGGTTTAGG - Intronic
1072407975 10:95172095-95172117 ACTGCTCGTCAGACACACATAGG + Intergenic
1073516381 10:104079116-104079138 GCTCCTGGTAAGTCACATTTGGG + Intronic
1074885078 10:117686881-117686903 GCCGATTGTCAGACACATGTGGG - Intergenic
1076305267 10:129461637-129461659 GCTGCTGATCAGACAGATGGAGG + Intergenic
1083194553 11:61077230-61077252 GCTGCTGGACAGGCAGATATAGG + Intergenic
1083407077 11:62464949-62464971 GCTCCTGGACAGACACAGTCGGG + Intronic
1084257393 11:67952456-67952478 GCTGTTGGTCAGACACACCCTGG + Intergenic
1087014780 11:93544044-93544066 GCTTTTGGTCAAACACGTTTAGG + Intergenic
1088059369 11:105627595-105627617 GCTGTTTGTAAGACCCATTTTGG + Intronic
1089129513 11:116200845-116200867 GCTACTGCTCTGAGACATTTAGG - Intergenic
1090890081 11:130915804-130915826 GCTCCTGGTCATACACCTTCTGG - Exonic
1091676160 12:2491680-2491702 GCTGCTGGGAAGACACAATCGGG + Intronic
1091685905 12:2562104-2562126 GCTCCTGAGCAGACCCATTTGGG - Intronic
1094061938 12:26323570-26323592 TCTGCAGGTGAGACACATTCTGG - Intergenic
1096789690 12:54037041-54037063 GCTGAAGGTCTGACTCATTTTGG + Intronic
1099144324 12:79020241-79020263 GCTGCTGGTTAAACTGATTTAGG - Intronic
1100618340 12:96248861-96248883 GCTTCTGGTCACAAGCATTTTGG - Intronic
1101814259 12:108133775-108133797 GCTTCTGGCAAGACAGATTTGGG - Intronic
1103548529 12:121719266-121719288 GATGCTGGACAGGCACCTTTTGG + Intronic
1104221639 12:126790192-126790214 GCTGCAGGTCAGACAACCTTTGG - Intergenic
1104681007 12:130751899-130751921 GATGCTGCTCAGACACATTGGGG - Intergenic
1105400168 13:20084923-20084945 ACTTCTGGTCAGAAGCATTTTGG - Intronic
1107738479 13:43423529-43423551 GTTGCCTGTCAGAAACATTTTGG - Intronic
1108696319 13:52905591-52905613 GCTGTGGGGCAGACACACTTTGG + Intergenic
1113752384 13:112785282-112785304 GCTGCTTTTTAGACACATTATGG - Intronic
1115977161 14:39009365-39009387 GCAGCTGGAAAGAAACATTTGGG - Intergenic
1119064844 14:71514638-71514660 GCAGCTAGTCAGACACAAATAGG - Intronic
1125828879 15:42697829-42697851 ACTTCTGGTCCCACACATTTTGG + Intronic
1131862772 15:96672326-96672348 GCTGAGGCTCAGAGACATTTAGG + Intergenic
1132165350 15:99581940-99581962 GCTGCTTGTTGGACACAGTTTGG + Intronic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1134208402 16:12256134-12256156 GCAGCTGGTCATACACCTGTTGG + Intronic
1135313472 16:21423318-21423340 ACTGGTGGTCAGACACAGGTAGG + Intronic
1135366396 16:21855596-21855618 ACTGGTGGTCAGACACAGGTAGG + Intronic
1135445419 16:22515568-22515590 ACTGGTGGTCAGACACAGGTAGG - Intronic
1135548998 16:23384115-23384137 GGTCCTGTTCAGAGACATTTTGG + Intergenic
1136152619 16:28361038-28361060 ACTGGTGGTCAGACACACGTAGG + Intronic
1136194131 16:28640135-28640157 ACTGGTGGTCAGACACACATAGG - Intronic
1136210463 16:28754243-28754265 ACTGGTGGTCAGACACACGTAGG - Intronic
1136310137 16:29402018-29402040 ACTGGTGGTCAGACACACGTAGG + Intronic
1136323583 16:29503823-29503845 ACTGGTGGTCAGACACAGGTAGG + Intronic
1136438268 16:30243792-30243814 ACTGGTGGTCAGACACAGGTAGG + Intronic
1136629861 16:31483526-31483548 TCTGCTGGTCAGCCACAATGTGG - Intronic
1137847980 16:51710568-51710590 ATTGCTGGTTAGAAACATTTCGG + Intergenic
1138157048 16:54715472-54715494 GCTGCTAGTCTGAAACATCTAGG - Intergenic
1138859591 16:60740487-60740509 GCTGCTGCTCCCACACAGTTTGG + Intergenic
1139445616 16:66996422-66996444 ACTGCCCCTCAGACACATTTAGG - Intronic
1139857822 16:69994422-69994444 ACTGGTGGTCAGACACACGTAGG + Intergenic
1140329758 16:74043075-74043097 GCTGCTGGTAAGACTCCTGTTGG - Intergenic
1142228976 16:88890535-88890557 TCACATGGTCAGACACATTTGGG + Intronic
1142801127 17:2346583-2346605 GCTTCTGGACAGACAGGTTTAGG - Intronic
1144948066 17:18979936-18979958 GCTGCTCTTCAGACACCTTTAGG - Intronic
1147679932 17:42235893-42235915 CCTGCTGGTCAAGCATATTTAGG + Intronic
1148219191 17:45850159-45850181 GCTGCAGGTCAGAATCATTGGGG + Intergenic
1149489355 17:57071166-57071188 GCCTCTAGTGAGACACATTTTGG - Intergenic
1150694859 17:67396114-67396136 GCTCCTTTTCAGACAAATTTTGG - Intronic
1150695190 17:67398639-67398661 GCTGCTGGTCTGATCCATTACGG - Intronic
1152047136 17:77944566-77944588 GCTGCTGATGAGACAGGTTTTGG + Intergenic
1153353516 18:4108761-4108783 GGTACAGGTCAGACACATCTGGG + Intronic
1154119270 18:11637675-11637697 ACTGGTGGTCAGACACACGTAGG + Intergenic
1154464761 18:14632672-14632694 GCTCCTGGTCATACACCTTCTGG - Intergenic
1156375120 18:36507445-36507467 ACTGCTGGTCCCAGACATTTTGG + Intronic
1156486640 18:37470538-37470560 GCTGCTGGGATGCCACATTTGGG - Intronic
1157131748 18:45013737-45013759 GCTGCTGCTCAGAAACAGTCAGG - Intronic
1157862855 18:51157039-51157061 ACTACTGCTCAGACACATTTAGG - Intergenic
1158739648 18:60125613-60125635 GCAGCTGGAAAGAAACATTTGGG + Intergenic
1159456369 18:68664202-68664224 GCTGCTTCTCAGTCAGATTTTGG + Intergenic
1160894751 19:1397182-1397204 GCTGCTGGTGACACACAGCTGGG + Intronic
1167145285 19:47677804-47677826 ACTGCTTGTCAGAAACCTTTAGG + Intronic
927298788 2:21486117-21486139 ACTGCTCCTGAGACACATTTTGG + Intergenic
928297318 2:30095698-30095720 GCTTCTGGTCCCACGCATTTTGG - Intergenic
931322639 2:61186266-61186288 ACTGCTGTTCTGAGACATTTTGG + Intronic
932268758 2:70390630-70390652 GCTGTATGTCAGACACTTTTAGG + Intergenic
932481138 2:72040093-72040115 GCTGCTGGGCAGACACCTTTGGG - Intergenic
933977084 2:87520315-87520337 TCTGCTGCTCAGACACACTTTGG - Intergenic
935757856 2:106290786-106290808 GCTACTGTTCAGCGACATTTGGG + Intergenic
936017645 2:108971922-108971944 GCTGCTGCTCAGTCACATAGGGG + Intronic
936224391 2:110634681-110634703 GCTACTGTCCAGCCACATTTGGG - Intergenic
936316733 2:111430490-111430512 TCTGCTGCTCAGACACACTTTGG + Intergenic
936501600 2:113070961-113070983 GCAGATGGGCAGGCACATTTAGG + Intronic
936992967 2:118385793-118385815 GCTGTGGGTCAGACTCATTGGGG - Intergenic
938876972 2:135541931-135541953 ACTTCTGGTCTCACACATTTTGG - Intronic
939719301 2:145628062-145628084 GCTGCTGCTCAGCCAGATTTGGG - Intergenic
941740784 2:169033025-169033047 CATGCTGGCCAGACACATCTGGG + Intergenic
942069704 2:172305198-172305220 GCAGGTGCTCACACACATTTGGG + Intergenic
942583533 2:177448551-177448573 GCTACAGAACAGACACATTTTGG - Intronic
944209195 2:197188818-197188840 TCTTATGGTCAGACACATTGGGG - Intronic
946248869 2:218401237-218401259 GCTGCTGATCAGCCCCATTGCGG - Intronic
947013208 2:225589128-225589150 GCTGCTTCTCAGACAAGTTTGGG - Intronic
947782582 2:232782545-232782567 GCTACTGCTTAGAAACATTTAGG - Intronic
948062800 2:235053910-235053932 GCGGCTGCTCAGACAGATTTAGG + Exonic
1169661151 20:7979806-7979828 ACTTCTGGTCCCACACATTTTGG - Exonic
1176809776 21:13525711-13525733 GCTCCTGGTCATACACCTTCTGG + Intergenic
1180831925 22:18910953-18910975 TCTGCTGGTCAGCCACCTTCCGG - Exonic
1181067920 22:20315389-20315411 TCTGCTGGTCAGCCACCTTCCGG + Exonic
1182486377 22:30641445-30641467 GCTGCCTGCCAGACAGATTTGGG + Intronic
1203282003 22_KI270734v1_random:136224-136246 TCTGCTGGTCAGCCACCTTCCGG - Intergenic
1203296418 22_KI270736v1_random:46851-46873 GCTGCTGGCCAGACCCACGTGGG - Intergenic
951124489 3:18967870-18967892 GCTGCTGATCAGCCTCACTTGGG - Intergenic
951228986 3:20155005-20155027 GCAGCTGGTCAATCACATTCTGG - Intergenic
952103584 3:30043419-30043441 GCTGCTGGGGAGACACAATTAGG + Intergenic
954451826 3:50575851-50575873 ACTGCTGGTTAGAAAAATTTTGG + Intronic
955229503 3:57086248-57086270 CTTGCTGGTCAGAGACATTCTGG - Intergenic
958736377 3:98014228-98014250 GCTGCTGGTTAGAAACAATAAGG + Intronic
961168949 3:124782299-124782321 GCTTCTGGTCAAACAGATATGGG - Intronic
961427533 3:126859838-126859860 GCTGCCTGTCAGAGACATTGAGG + Intronic
964220515 3:154339442-154339464 CCAGGTGGACAGACACATTTAGG - Intronic
965155274 3:165044212-165044234 TCTTCTGGTCCCACACATTTTGG + Intronic
967410528 3:189162327-189162349 GCAGCTTGTGAGACATATTTGGG + Intronic
968808968 4:2791717-2791739 CCTGCTGGAGAGACACACTTGGG - Intergenic
973115502 4:46452778-46452800 ACTGCTGGTGAGATACATATAGG - Intronic
973260075 4:48154299-48154321 CCTACTGGTCAGACAGGTTTAGG + Intronic
973264466 4:48197818-48197840 GCTGCTGGCCTGAGCCATTTGGG - Intronic
975807704 4:78130012-78130034 GCTGCCAGTCAGACACAGTAAGG - Intronic
977006759 4:91576559-91576581 GCTTCTGGTCCCAAACATTTCGG - Intronic
977012046 4:91648481-91648503 GCTGCTGGAGAAACAGATTTTGG + Intergenic
979633304 4:122927951-122927973 GCTCCTGGTCCCAAACATTTTGG + Intronic
982405296 4:155013085-155013107 GTTTCTGGTCAGATATATTTGGG + Intergenic
986372483 5:7093737-7093759 CCTTCTGGTGAGCCACATTTTGG - Intergenic
986417138 5:7540474-7540496 GAGGATGTTCAGACACATTTGGG - Intronic
988580179 5:32461996-32462018 CTTGCTGGTAAGACTCATTTGGG - Intergenic
988943780 5:36173703-36173725 GCTGCTTGCTAGACACATTCAGG + Intronic
991337742 5:65568194-65568216 ACTTCTGGTCCGATACATTTTGG + Intronic
992125284 5:73633375-73633397 GCTGCAGGTCAGAGAGACTTGGG + Intronic
992782493 5:80140852-80140874 GCTGCTGGTCAGACACATTTAGG - Exonic
995104137 5:108353933-108353955 GCTTCTGGTCCCAAACATTTTGG - Intronic
995764489 5:115601360-115601382 CCTGATGGTAAGACGCATTTGGG - Intronic
996279300 5:121708802-121708824 TCTGCTTGTAAGTCACATTTAGG + Intergenic
1000436301 5:161213974-161213996 GCTGCTGGTCTGACACACTACGG - Intergenic
1001595867 5:172898404-172898426 TGTGCTGGTCAAACACATGTGGG - Intronic
1003308393 6:4948272-4948294 CTTGATGTTCAGACACATTTTGG + Intronic
1003768568 6:9269947-9269969 ACTGTGGGTCAGACACGTTTGGG - Intergenic
1005080667 6:21953539-21953561 GCTGCTTGTCTTACACAGTTGGG - Intergenic
1005173086 6:23010941-23010963 GGTGCTGGTCTGAAACAGTTCGG + Intergenic
1005670262 6:28098687-28098709 TCTGCTGGTCAGACAGGTTTAGG + Intergenic
1007567644 6:42864703-42864725 GCTGCTCATGAGACACAGTTTGG + Exonic
1007837389 6:44684187-44684209 AGTGGTGGGCAGACACATTTGGG + Intergenic
1014178141 6:118352264-118352286 TCTGGTGATCAGACCCATTTTGG - Intergenic
1015424995 6:133055182-133055204 GCTTCTGGTCAGACAGGCTTAGG + Intergenic
1017896766 6:158686823-158686845 GATGCTGGCCAGACACAGGTCGG + Intronic
1018369261 6:163152696-163152718 GCTGCTAGGCAGGCAGATTTTGG - Intronic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1020177497 7:5894739-5894761 GCTGTGGGAAAGACACATTTTGG - Intergenic
1020305416 7:6830206-6830228 GCTGTGGGAAAGACACATTTTGG + Intergenic
1020736997 7:11963231-11963253 TCTGCTGGTCAGACACATTTAGG - Intergenic
1022281469 7:28914749-28914771 GCAGCAGATCAGACATATTTTGG + Intergenic
1026287186 7:68973625-68973647 GCAGGTGGGCAGACACAGTTGGG - Intergenic
1028789124 7:94833864-94833886 GATGCTGGCCAGGGACATTTCGG - Intergenic
1029074595 7:97925892-97925914 GCTGTTGGTCAGACACACCCTGG + Intergenic
1029081341 7:97976262-97976284 GCTGTGGGAAAGACACATTTTGG + Intergenic
1030046674 7:105503261-105503283 TCTGCTGGACAGACACCTTAGGG + Intronic
1032062091 7:128733441-128733463 GTTGCTGGTGTGACATATTTGGG - Intergenic
1036098870 8:5755716-5755738 GCTGAAGGTCAGACACATGGTGG - Intergenic
1036978308 8:13440057-13440079 TCTTCTGGTCAAATACATTTGGG + Intronic
1037103270 8:15074141-15074163 GCTGATGGTCACAGACATCTGGG - Intronic
1038271673 8:26080817-26080839 GGTGCAGGTAAGCCACATTTTGG - Intergenic
1038468438 8:27788847-27788869 GACGCTGGTCAGAAACATTTTGG + Exonic
1039893861 8:41702308-41702330 GCTGCTGCTAACACACATCTAGG - Intronic
1043626498 8:82267195-82267217 GCTGATGGTCAGACAGAGCTGGG + Intergenic
1044100387 8:88128835-88128857 GATGGTGGTCAGACTCATTTGGG + Intronic
1044778111 8:95714878-95714900 GATGCTTGTCAAATACATTTTGG - Intergenic
1045385396 8:101667188-101667210 CTTTCTGGTCAGACACCTTTAGG + Exonic
1048402813 8:134087726-134087748 GCTCCTGGTCAGCCCCATCTGGG - Intergenic
1049448081 8:142640865-142640887 GCTCCTGGTCCCACAGATTTGGG + Intergenic
1050635606 9:7609007-7609029 GATGCTGGGCAGACACAGTTTGG + Intergenic
1051188079 9:14481624-14481646 GCAGGTGGTCAGGCAAATTTTGG - Intergenic
1053062633 9:35043953-35043975 GATGCTGGTGGGACACATTCAGG - Exonic
1203449886 Un_GL000219v1:101935-101957 TCTTATGGTCAGACAAATTTTGG + Intergenic
1188364133 X:29293911-29293933 GCTGCTGATCAGCAAAATTTGGG + Intronic
1190397016 X:49995299-49995321 GCTGCTGATAAGACATTTTTGGG + Intronic
1196339595 X:114582127-114582149 GCTGCTCGGCAGATCCATTTTGG + Intergenic
1196694460 X:118596299-118596321 GATGCCCGTCAGGCACATTTCGG + Intronic
1197688593 X:129472694-129472716 ACTTCTGGTCTGAAACATTTGGG - Intronic
1199536772 X:148911616-148911638 TCCTCTGGTCAAACACATTTGGG - Intronic