ID: 992786811

View in Genome Browser
Species Human (GRCh38)
Location 5:80177796-80177818
Sequence CACAGTGTCTGGTGGGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 455
Summary {0: 1, 1: 0, 2: 5, 3: 51, 4: 398}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992786805_992786811 12 Left 992786805 5:80177761-80177783 CCTAAATCAACAATTTCAACTAG 0: 1
1: 0
2: 1
3: 31
4: 268
Right 992786811 5:80177796-80177818 CACAGTGTCTGGTGGGCAGATGG 0: 1
1: 0
2: 5
3: 51
4: 398
992786803_992786811 14 Left 992786803 5:80177759-80177781 CCCCTAAATCAACAATTTCAACT 0: 1
1: 0
2: 0
3: 23
4: 317
Right 992786811 5:80177796-80177818 CACAGTGTCTGGTGGGCAGATGG 0: 1
1: 0
2: 5
3: 51
4: 398
992786802_992786811 18 Left 992786802 5:80177755-80177777 CCTTCCCCTAAATCAACAATTTC 0: 1
1: 0
2: 2
3: 35
4: 252
Right 992786811 5:80177796-80177818 CACAGTGTCTGGTGGGCAGATGG 0: 1
1: 0
2: 5
3: 51
4: 398
992786804_992786811 13 Left 992786804 5:80177760-80177782 CCCTAAATCAACAATTTCAACTA 0: 1
1: 1
2: 1
3: 37
4: 360
Right 992786811 5:80177796-80177818 CACAGTGTCTGGTGGGCAGATGG 0: 1
1: 0
2: 5
3: 51
4: 398
992786801_992786811 21 Left 992786801 5:80177752-80177774 CCACCTTCCCCTAAATCAACAAT 0: 1
1: 0
2: 0
3: 29
4: 285
Right 992786811 5:80177796-80177818 CACAGTGTCTGGTGGGCAGATGG 0: 1
1: 0
2: 5
3: 51
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992786811 Original CRISPR CACAGTGTCTGGTGGGCAGA TGG Intronic
900093211 1:929561-929583 GGCAGGGTGTGGTGGGCAGAAGG + Intronic
900509235 1:3050612-3050634 CAGAGTGTCTGGTGGGGCAAGGG + Intergenic
900697851 1:4023306-4023328 CACAGTGGCAGGTGGGCTCAGGG - Intergenic
900760404 1:4466719-4466741 CACTGTGTCTGCAGGGCAGTAGG - Intergenic
901190944 1:7409395-7409417 CTTAGTGGCTGGTGGCCAGAGGG - Intronic
901679376 1:10904273-10904295 CCCAGTGTCTGGAGGCCAAACGG + Intergenic
901886717 1:12228831-12228853 CACTCTGTCTGGAGTGCAGAGGG + Intergenic
902203222 1:14849187-14849209 CACAGTGTCTGGTGCACACTGGG + Intronic
903070419 1:20724396-20724418 CAGAGGGGCTGGTGGGCAGTGGG - Exonic
903342313 1:22662132-22662154 GACTGTATCTGGTGGGCAGTGGG - Intergenic
903756360 1:25664133-25664155 CAGAGCGTGTGGAGGGCAGATGG - Intronic
903944208 1:26951580-26951602 CACAGTGTCTGATGTGCACTTGG + Exonic
904128374 1:28258714-28258736 GAGAGTGTCTGGAGGGAAGAGGG + Intergenic
904257145 1:29260928-29260950 CTCAGTCTCTGGTGGGCCCAGGG + Intronic
904356344 1:29942565-29942587 CACAGGGTCTGGGGGGCAGAGGG + Intergenic
904375935 1:30082554-30082576 CTCAGTGCCTGGAGGGCTGATGG + Intergenic
904396467 1:30225531-30225553 CCCAGTGTCTGACGGCCAGATGG - Intergenic
906436681 1:45802697-45802719 CACAGTGTGTGGTATGCAGTGGG + Intronic
906812251 1:48839823-48839845 CCCAGTGTGTGGTGGACAGAGGG + Intronic
907467579 1:54649439-54649461 CACAGTGTCTGTTTGGTAGAGGG + Intronic
907892514 1:58649176-58649198 CAGAGTCTCAGGTGGGAAGAAGG - Intergenic
907920666 1:58908585-58908607 CAGAGTGTGTGCTGGGCAGGAGG + Intergenic
911043164 1:93607881-93607903 TGCTGTGTCTGGTGGGCGGATGG - Intronic
911156731 1:94644269-94644291 AACAGTGTTTGGTGGGTAGCAGG + Intergenic
915466382 1:156100765-156100787 CACAGTGCCTGGTGCACAAAAGG - Intronic
916423487 1:164659048-164659070 CACAGTGTCTGATGGGTAGGAGG + Intronic
916465287 1:165067906-165067928 CAGAGTGTCTGGTATGCAGTGGG + Intergenic
916825078 1:168435255-168435277 CACAGAGTCTGCTGGGGGGATGG - Intergenic
918319362 1:183350062-183350084 CACAATGTCTGGTGCACAGCAGG - Intronic
919158414 1:193797838-193797860 CACAGTGAGTGGTGGGTATATGG + Intergenic
919251515 1:195062385-195062407 CACAATGCCTGTTTGGCAGAAGG + Intergenic
919944874 1:202311831-202311853 CACAGTGTATGGAGGGCAAATGG + Intronic
920060014 1:203220859-203220881 CACACTGTGTGGTGAGTAGAAGG + Intronic
921300720 1:213749250-213749272 GAGAGTGTTTGGCGGGCAGAAGG + Intergenic
921382598 1:214540327-214540349 CACAGTATTTCCTGGGCAGAAGG + Intronic
921972197 1:221162295-221162317 CACAATGTCTGCTGGGCATTTGG + Intergenic
922814187 1:228437591-228437613 CACAGTGTCTGTGTGGCAGTCGG - Intergenic
923335951 1:232970360-232970382 CCTAGTGTCTGGTGAGGAGATGG - Intronic
924044223 1:240011318-240011340 CACAGTGTGAGCTGGTCAGATGG - Intergenic
924200746 1:241655965-241655987 CACAGGGCCTGGTGTCCAGAAGG + Intronic
1063556611 10:7086221-7086243 CACATTTTGTGGTGGGAAGAGGG + Intergenic
1064535612 10:16354670-16354692 CATTGTGTCTGGTGGGCTGGAGG - Intergenic
1064780757 10:18835762-18835784 CACAGTGTCTGGAAGTCTGATGG - Intergenic
1065117795 10:22499082-22499104 CACAGAATCTTGTGGCCAGAGGG + Intergenic
1065488204 10:26255020-26255042 GAGAGTGTCTGGTAGGCAGGTGG + Intronic
1066352144 10:34645609-34645631 CATACTGTCTGCTGGTCAGATGG - Intronic
1067064085 10:43093913-43093935 CACAGTGGCAGGTGGGGAGGCGG + Intronic
1067689876 10:48494855-48494877 CAAAGTTTCTGGTGGGAAGAGGG - Intronic
1067789697 10:49278397-49278419 CAGAGTGCCTGGAAGGCAGATGG - Intergenic
1067838321 10:49655313-49655335 CAAAGCATCTGGTGGTCAGAGGG - Intronic
1068834765 10:61541842-61541864 TACAGTGGCTTGTGGGCAGGTGG + Intergenic
1069086895 10:64151124-64151146 ACCAGAGGCTGGTGGGCAGAGGG - Intergenic
1069706605 10:70462685-70462707 CACAGTGCCAGGGGGGCACAAGG - Intergenic
1069750888 10:70744276-70744298 CACAGTCTGGGGTGGGGAGAAGG + Intronic
1070645511 10:78199494-78199516 CAGAGGGGCTGGGGGGCAGAAGG + Intergenic
1070691410 10:78529713-78529735 CCCAGTGTCTGGTATCCAGAGGG + Intergenic
1071124446 10:82318058-82318080 CTTTGTGTCTGGTGGGCAGGGGG + Intronic
1072802889 10:98405505-98405527 CACAGTGCCTGGTGCACAGAGGG - Intronic
1073006075 10:100325800-100325822 CACAGTGTCTGTCTGGCACATGG - Intronic
1073045385 10:100634610-100634632 CACAGTGCCCGGTGGGCACGGGG + Intergenic
1073471194 10:103723352-103723374 CCCAGGAGCTGGTGGGCAGAAGG - Intronic
1074346657 10:112692864-112692886 CTCACTGTCTGGTGGGGAGATGG - Intronic
1074944612 10:118269477-118269499 CACAGTGCCTGATGTGCAGAAGG + Intergenic
1075265502 10:120997207-120997229 CACAGTGTCAGGGGGCCAGCAGG - Intergenic
1077177452 11:1197210-1197232 CACAGTCTTGGCTGGGCAGAAGG - Intronic
1077334336 11:1996809-1996831 CCCAGGGTCTGGTGCGGAGAGGG - Intergenic
1077474157 11:2778545-2778567 CACAGAGCCTGGTGGGGAGTGGG - Intronic
1077672454 11:4168255-4168277 CACTTTATCTGGTGGGCAGTGGG - Intergenic
1078102871 11:8339978-8340000 CACAGCGTCTTTTGCGCAGAAGG + Intergenic
1078659516 11:13276077-13276099 CACAGTGTCTGGTACGTAGTAGG + Intergenic
1079231072 11:18649287-18649309 AACAGTGTTTTGTGGGCAGGGGG - Intergenic
1080639117 11:34148558-34148580 CACTCTGTCTGGGGGCCAGATGG - Intergenic
1083633915 11:64109800-64109822 CACAGTTTGAGGTGGGCAGGGGG + Intronic
1083738570 11:64695420-64695442 CACAGTGTCAAGTGGGAAGAAGG + Intronic
1083946059 11:65923578-65923600 AACAGTGTCTGGTGTGCAATAGG - Intergenic
1084021874 11:66422601-66422623 GACAGTGGATGGTGGGGAGAAGG - Intronic
1084500063 11:69530141-69530163 CACAGGGTCAGCTGGGGAGATGG + Intergenic
1085478683 11:76804505-76804527 CCCAGTGGCAGGTGGGGAGAAGG - Intergenic
1086215175 11:84370560-84370582 CACAGTGTGTGGTGTACAGTAGG + Intronic
1086403714 11:86482349-86482371 CTCAGTGTCTGGTGTACAGCAGG + Intronic
1087004181 11:93452888-93452910 CACAGGGTCTTGTGCTCAGAAGG + Intergenic
1089538102 11:119173016-119173038 CAGGGGGTGTGGTGGGCAGACGG + Intronic
1090807472 11:130211353-130211375 GCCAGTGTCAGGAGGGCAGAAGG + Intergenic
1202817319 11_KI270721v1_random:51991-52013 CCCAGGGTCTGGTGCGGAGAGGG - Intergenic
1094525225 12:31226879-31226901 CACAGGGTCTGGTGGGCAGGAGG + Intergenic
1096755618 12:53797053-53797075 CACAGTGTCTGGTAGCTAGCTGG - Intergenic
1098171521 12:67751803-67751825 CGCAGTGGCTGGAGGGCCGAAGG - Intergenic
1098872867 12:75836234-75836256 CACTGTGCCTGGTGTGGAGAGGG - Intergenic
1098970863 12:76855504-76855526 AACAGTGTCTGGTGCGCACATGG - Intergenic
1099203983 12:79707498-79707520 CACAGTGTCTGGAGTACAGCAGG + Intergenic
1100068032 12:90674646-90674668 CACAGTGTCAGGGAGACAGAAGG + Intergenic
1100217469 12:92467143-92467165 GACAGTTTCAGATGGGCAGATGG - Intergenic
1100282188 12:93128474-93128496 CACAGTGACTGGAGGTGAGAAGG - Intergenic
1100543374 12:95578892-95578914 CACAGTGTCTGGAGTACAAAAGG + Intergenic
1101639744 12:106579365-106579387 CAAACTGTGTGGTGGCCAGATGG - Intronic
1101734101 12:107449997-107450019 CACAGTGCCTGGTATGCAGTAGG + Intronic
1101787980 12:107902927-107902949 CACAGTGTCGGGCATGCAGAAGG - Intergenic
1101957338 12:109222936-109222958 CACAGTGTGTGCTCTGCAGATGG - Intronic
1102764943 12:115424181-115424203 AACAGTGTCTGGTGTGTAGTAGG - Intergenic
1103202136 12:119096492-119096514 CTCAGTGTCTGGTGTGCAGGAGG + Intronic
1103270645 12:119670256-119670278 AACAGGGTATGTTGGGCAGAGGG - Intronic
1103981837 12:124741828-124741850 CACGGGGTCTGGTAGGCAGTTGG - Intergenic
1105529220 13:21203104-21203126 CATAGTGCCTGGTGGGCACCAGG - Intergenic
1105579545 13:21681867-21681889 CACAGTGTGTGGTACGCAGCAGG + Intronic
1106346659 13:28886099-28886121 CAGAGTTGCTGGTGGGGAGAGGG + Intronic
1106480627 13:30134508-30134530 CACAGTGCATGGTAGCCAGAAGG - Intergenic
1106812047 13:33368368-33368390 CACAGTGTCTGGTACATAGAAGG - Intergenic
1108569481 13:51735283-51735305 CACAGTGACTGGTATGCAGGAGG - Intronic
1109004839 13:56859415-56859437 CTCAGTGGCTAATGGGCAGATGG + Intergenic
1110176832 13:72567272-72567294 CACAGTGCATGGTGGGAAGGTGG - Intergenic
1110641304 13:77827904-77827926 CACAGTGGCTGATGAGAAGAAGG + Intergenic
1112219363 13:97472154-97472176 CACAGTGACTGACAGGCAGAGGG - Intergenic
1112761534 13:102698124-102698146 CACAGTGCCAGGTGCTCAGAGGG + Intergenic
1117495452 14:56297658-56297680 CAGTGTGACTGGTGGACAGATGG + Exonic
1118681286 14:68244524-68244546 CATAGTGTCTGCTGGACAGTTGG + Intronic
1119407268 14:74406661-74406683 CTCAGTGGCTGGTGAGCTGAGGG + Exonic
1119655088 14:76411584-76411606 CACAGTGTCTAGTAGGAAGTGGG - Intronic
1119772005 14:77225879-77225901 CTCAGTGCCTGGAGAGCAGAGGG + Intronic
1120547586 14:85829856-85829878 CAGGGTGGCTGCTGGGCAGAGGG + Intergenic
1120964280 14:90153879-90153901 CACATTCTTTGGTGGGCAGATGG - Intronic
1121383996 14:93500361-93500383 GACAGTGCCTGGAGGGCAGCAGG - Intronic
1121888292 14:97564853-97564875 AAAAGTGTCAGGTTGGCAGAAGG + Intergenic
1121992527 14:98573622-98573644 CACACTGTCTTGAGGGTAGAAGG + Intergenic
1124361442 15:29039393-29039415 CACAGTTTCTGATGGGGAGCTGG - Intronic
1125501453 15:40242318-40242340 CACAGTGTCCTGGGTGCAGAAGG + Intronic
1125511669 15:40295453-40295475 CACAGTGCCTGCTGGGGTGAGGG + Intronic
1125755933 15:42065101-42065123 CACAGCCTGTGGTGAGCAGAGGG + Intergenic
1125756757 15:42070088-42070110 TGCAGTGCCTGGTGGGGAGAAGG + Exonic
1127039533 15:54959037-54959059 AACAGTGTCAGGTGTTCAGATGG - Intergenic
1127289000 15:57553944-57553966 CGCAGTGTGTGGTGGGCTGGAGG + Intergenic
1127373459 15:58361181-58361203 CACCATGTGTGGTGGGCAGGTGG - Intronic
1127559501 15:60121873-60121895 CACAGTAGTTGGGGGGCAGAGGG - Intergenic
1128119401 15:65134529-65134551 GAGAGTGTCTGGTGGAGAGAAGG - Intergenic
1128452729 15:67815502-67815524 CACAGTGTCTGGTGCACAGTGGG + Intergenic
1128570374 15:68729283-68729305 CGCAGTGTGTAATGGGCAGAGGG - Intergenic
1129920263 15:79313685-79313707 CACAGTGTCTGGTTGGCATTTGG + Intronic
1129961956 15:79695007-79695029 CACAGCATCTGGAGGGAAGAAGG - Intergenic
1130575725 15:85091594-85091616 CACAGTGTCTGGCTAACAGAAGG - Intronic
1131313073 15:91308243-91308265 CACAGAGTCTGGTGGGCTTCAGG - Intergenic
1131506701 15:93025851-93025873 CACATCATGTGGTGGGCAGATGG + Exonic
1131647708 15:94363205-94363227 CACATTGTATGCTGGGCAGAAGG + Intronic
1132759244 16:1500883-1500905 CACAGGGTCGGGTGAGCACAGGG + Intronic
1132837010 16:1959239-1959261 CACAGTGCCTGGCGCGCAGTGGG + Intergenic
1133129028 16:3664797-3664819 GTCAGTCTCTGGTGGGCACACGG + Exonic
1133699025 16:8291786-8291808 AACAGTGGCTGGTGCACAGAAGG - Intergenic
1135053164 16:19208692-19208714 CACAGTGTCTGGTGGTTGGCTGG + Intronic
1135471514 16:22735772-22735794 CACAGTGCCTGGTGTACAGTAGG + Intergenic
1136136376 16:28259089-28259111 CGAGGTGGCTGGTGGGCAGACGG - Intergenic
1136273974 16:29167045-29167067 GGCAGGGTCTGGTGGGCAGGAGG + Intergenic
1136476482 16:30516905-30516927 CACAGGGTCTGGGGGGCAGCTGG + Intronic
1136547998 16:30966082-30966104 CACAGGGGCAGGAGGGCAGAGGG + Exonic
1137068519 16:35877104-35877126 CTCAGTGTCTGGCTGGCAGTGGG - Intergenic
1137540690 16:49359731-49359753 CATAGTGCCTGGTTGGCAGTGGG + Intergenic
1137699812 16:50489389-50489411 CACAGTGCCTGGTGGCAAGCAGG + Intergenic
1138271758 16:55700532-55700554 CACAGTGTCTGGCGCACAGGAGG + Intronic
1138721962 16:59092636-59092658 CACAGTGCTTGGTATGCAGATGG - Intergenic
1139126519 16:64084901-64084923 CACTGTGCCTGGGGGCCAGATGG - Intergenic
1139264213 16:65623965-65623987 TGCAGAGTCTGGTGGGGAGAGGG - Intergenic
1141393736 16:83686267-83686289 CACAAAGTCTCGTGGGAAGATGG - Intronic
1141461894 16:84182644-84182666 CACAGTGACTGGTTCACAGATGG + Intronic
1141643976 16:85357590-85357612 CACAGTGTCTGCAGAGCAGCCGG + Exonic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1141887987 16:86905961-86905983 GCCAGTGTCTGCTAGGCAGAAGG + Intergenic
1142098576 16:88259346-88259368 CGCAGAATCTGGCGGGCAGAGGG - Intergenic
1142969394 17:3601120-3601142 CACCGGGTTTGGTGGCCAGAAGG - Intergenic
1143682962 17:8491251-8491273 TACAGTGTCTGGTGCTCAGTAGG + Intronic
1145064105 17:19750286-19750308 AACAGTGCCTGGCGGGCCGAGGG + Intergenic
1146259720 17:31413483-31413505 CTCAGTGGCTGGAGGGCAGGGGG - Intronic
1146648180 17:34589350-34589372 CACAGTGACTGGCAGGCTGAGGG + Intronic
1146648989 17:34594901-34594923 CACAGTGCTTGGTGTGCAGTAGG - Intronic
1147170848 17:38617878-38617900 CAGGGTGTCTGGTGTCCAGAAGG - Intergenic
1148800403 17:50221354-50221376 CACAGTGCCTGGCGCACAGAAGG + Intergenic
1149081300 17:52660846-52660868 CACAGTGTCTGGCATGCAGCAGG + Intergenic
1149429702 17:56587976-56587998 GACAGTGTATGGTGGGGAGCGGG + Intergenic
1150264107 17:63820786-63820808 CCCAGGGTCTGGTGGGTAAATGG - Intronic
1150787351 17:68173841-68173863 GACAGTGTCTGAAGGGCAGGTGG + Intergenic
1150893469 17:69182674-69182696 CATAGTGTCTGGTGACCAGAAGG - Exonic
1151377800 17:73703275-73703297 CACAGAGCCTGCTGGTCAGATGG - Intergenic
1151683690 17:75634836-75634858 CTCAGGCTCAGGTGGGCAGAAGG + Intronic
1152563085 17:81088345-81088367 CACAGAGCCTCGAGGGCAGAAGG - Intronic
1154413157 18:14153812-14153834 CACAGTGTCTGCTGGGTTGGGGG - Intergenic
1154424018 18:14258414-14258436 CTCAGTGGCTCATGGGCAGAAGG + Intergenic
1156852835 18:41747937-41747959 CACAGTGTCTGGAAGGAAAAAGG + Intergenic
1157466786 18:47954147-47954169 CACAGTTACTGGTAGGCACAGGG - Intergenic
1157497822 18:48169059-48169081 CACAGGGTCTGCTGTCCAGATGG + Intronic
1157572281 18:48721048-48721070 CCCACTGCCTGGTGGGCACAGGG - Intronic
1157716792 18:49893574-49893596 CAGAGGGTCCTGTGGGCAGAGGG + Intronic
1158155075 18:54416696-54416718 CCCAGTGTCTGGAATGCAGAAGG - Intergenic
1158608764 18:58919646-58919668 CCCAGTGTCTGCTGTGAAGACGG + Exonic
1158825049 18:61209124-61209146 CAGAAGGTCTGGTGGGAAGATGG - Intergenic
1160153969 18:76418898-76418920 CAGAGGGTCTGCAGGGCAGATGG + Intronic
1160178852 18:76617485-76617507 CACTGTGTCCTGAGGGCAGAGGG + Intergenic
1160272164 18:77397143-77397165 CACAGGCTCTGGTGGGCACTGGG + Intergenic
1160677539 19:399425-399447 CACAGTGGCTGGTGGGCGGGGGG + Intergenic
1160911455 19:1475750-1475772 CACAGTGGCTGGGTGGCAGGAGG + Intronic
1161151301 19:2711471-2711493 AACAGTGCCTGGTGGGCTGTGGG - Intergenic
1161589007 19:5120392-5120414 CACAGCCACTTGTGGGCAGAGGG + Intronic
1161624783 19:5320006-5320028 CACAGAGCCTGGTGGACAGGAGG + Intronic
1161935908 19:7372126-7372148 CACAGGGTTTGGTGGGTAGGTGG - Intronic
1162439203 19:10682352-10682374 CACTGTGGCTGGCAGGCAGAGGG + Intronic
1162785636 19:13033037-13033059 CACAGGGCCTGGTTGGCAGACGG + Intronic
1164051248 19:21586983-21587005 CGCAGTGGCTGGTGGGCAGTGGG + Intergenic
1164621172 19:29696868-29696890 CAGGGTGTCTGGGTGGCAGAGGG + Intergenic
1164621330 19:29697554-29697576 CAGGGTGTCTGGGTGGCAGAGGG - Intergenic
1166382428 19:42362021-42362043 GACAGTGTCTGGGAGGCAGAAGG + Intronic
1166386080 19:42382092-42382114 CACAGTGCCTGGAGGGCTGTAGG - Intergenic
1167908791 19:52684628-52684650 GATAGAGACTGGTGGGCAGAGGG + Intronic
1168113819 19:54209683-54209705 CACAGAGCCTGGAGGGCAGATGG + Intronic
925167590 2:1727682-1727704 CAGGGGGTCTGGTGGGCAGGGGG - Intronic
925275134 2:2643402-2643424 CACAGCGGCTGGTGGGCATCCGG - Intergenic
925926832 2:8676950-8676972 CACGGACGCTGGTGGGCAGAGGG + Intergenic
927152876 2:20205779-20205801 CACAGTGTAGGGTGGGCTGATGG - Intronic
927475246 2:23409673-23409695 CACAGTGCCTGGCACGCAGAAGG - Intronic
927481106 2:23454832-23454854 CATAGTGTCTGGTGGGCAGGAGG - Intronic
927646076 2:24877775-24877797 CTCTCTGTCTGGTGGTCAGATGG - Intronic
931882926 2:66585691-66585713 CCCAGTGTCTGGTGTCCAGAAGG - Intergenic
931927121 2:67085672-67085694 CACCCTGTCTGGTGGGAAGGTGG - Intergenic
932457418 2:71858316-71858338 CACAGTGTGTGGTGGGCCTGGGG - Intergenic
932739754 2:74282612-74282634 CACTGGGTCTGGAGTGCAGAGGG + Intronic
932829437 2:74974860-74974882 AAAAGTATATGGTGGGCAGAAGG + Intergenic
934114037 2:88766490-88766512 GACAGTGTGGGGTGGGGAGATGG + Intergenic
934520804 2:95019025-95019047 ACCAGAGGCTGGTGGGCAGAGGG - Intergenic
934576452 2:95404717-95404739 CACTGTGCCTGGTGCACAGAAGG - Intronic
934638677 2:96012883-96012905 CACTGTGCCTGGTGTACAGAAGG - Intergenic
934781527 2:96972349-96972371 GACAGTGGCAGGTGGGCAGAGGG - Intronic
934794971 2:97092519-97092541 CACTGTGCCTGGTGCACAGAAGG + Intronic
935936438 2:108189499-108189521 CACTGTGTCTGCTGCCCAGAAGG + Intergenic
936233864 2:110726448-110726470 CACAGGGTCTGGTAGGGAGGTGG - Intergenic
936751861 2:115652302-115652324 CACAGTGTCTTGTGTACAGTAGG + Intronic
937419595 2:121742509-121742531 CCCAGGCTCTGGTGGGCAGGGGG + Intronic
938792354 2:134688105-134688127 AGCAGTGTCTGGTGCGCAGTGGG - Intronic
941786627 2:169505750-169505772 CAGGGTGGCTGCTGGGCAGAGGG - Exonic
943411726 2:187556692-187556714 CAGGGTGGCTGCTGGGCAGAGGG - Intronic
945316663 2:208377616-208377638 CAGGGTGGCTGCTGGGCAGAGGG + Intronic
946152276 2:217784803-217784825 CACAGTGTGGGGTGGGGAGGGGG - Intergenic
946182995 2:217960132-217960154 CCCAGTGAGTGGGGGGCAGAAGG + Intronic
946315147 2:218906488-218906510 CCCAGTGTCTGGTGGGCTGGGGG + Intergenic
946382428 2:219358323-219358345 CAGGGTGCCTGGTGGGCAGAGGG - Intergenic
947499150 2:230659620-230659642 CGCAGTGGCTGGTGGGCACCTGG + Intergenic
947527732 2:230889496-230889518 CACAGAGTCTCGTGGGCATCAGG + Intergenic
947795937 2:232894042-232894064 GACAGTGCCTGGTGATCAGATGG - Intronic
948454131 2:238096924-238096946 CACTGGGTGTGGTGGGCAGGCGG + Intronic
948880675 2:240855783-240855805 AACAGTGACTTGTGGGGAGAGGG - Intergenic
948880680 2:240855807-240855829 AACAGTGACTTGTGGGGAGAGGG - Intergenic
948880685 2:240855831-240855853 CACGGTGACTTGTGGGGAGAGGG - Intergenic
1168932553 20:1635771-1635793 CACAGTGCCTGGTGCACAGTAGG + Intronic
1169100017 20:2939466-2939488 CACAGTGTCTGGTGAGGAAAAGG + Intronic
1169118546 20:3082518-3082540 CTCAGTCTCTGGCGGGAAGAGGG - Intergenic
1170622095 20:18004814-18004836 CCCAGAGTCTAGTGGGGAGATGG - Intronic
1170640154 20:18144882-18144904 CCCAGTGCCTGGTATGCAGAGGG + Intronic
1172248083 20:33459820-33459842 CAAAGTGTACGGTGGACAGAGGG + Intergenic
1172582134 20:36056711-36056733 CACAGTGCCTGGTATGCAGTAGG + Intergenic
1172669798 20:36627145-36627167 CAGAGTGGCTGGTGGGCAGAGGG + Intronic
1172828270 20:37808888-37808910 CACAGTGGGTGGTGGGGAGGAGG - Intronic
1173163924 20:40672683-40672705 AACAGTGTCTGGTGGATACATGG - Intergenic
1174082746 20:47982820-47982842 CGCAGTGGGTGGTGGGCAGGGGG - Intergenic
1174403845 20:50291292-50291314 CAGAGTGGCTGGTGGGGAGGTGG + Intergenic
1174412212 20:50343584-50343606 CAGGGTCCCTGGTGGGCAGATGG + Intergenic
1175080799 20:56418825-56418847 AACAGTGCCTGGTGTGCAGCAGG - Intronic
1175582727 20:60113023-60113045 CACAGTGCCTGGTGCACAGCGGG - Intergenic
1176061327 20:63174177-63174199 CCCCGTGCCTGGTGGGGAGAGGG - Intergenic
1176859854 21:14004444-14004466 CACAGTGTCTGCTGGGTTGGGGG + Intergenic
1177904489 21:26959003-26959025 CACAGGATCTGTTGAGCAGAGGG + Intronic
1178938992 21:36889320-36889342 CGCAGTGTGTGGTGAGCAGATGG - Intronic
1179175964 21:39008452-39008474 CACAGTCCCTGGGTGGCAGATGG + Intergenic
1179828158 21:43979847-43979869 CACAGTGTGTGGCTGGCAGGGGG + Intronic
1180002041 21:44999562-44999584 CCCAGTACCTGGTGAGCAGAGGG - Intergenic
1180905501 22:19408086-19408108 CACACTGTCTGATGGCCAAAAGG + Intronic
1181601578 22:23955366-23955388 CCCAGTGCCTGATGGGGAGAGGG + Intergenic
1181606922 22:23985932-23985954 CCCAGTGCCTGATGGGGAGAGGG - Intergenic
1181672079 22:24430375-24430397 CACTGAGGCTGGTGGGCAGCAGG + Intronic
1181715697 22:24726012-24726034 CACAATGTCAGGTGGTCAGATGG - Intronic
1182273184 22:29168733-29168755 CCCAGGGCCTTGTGGGCAGAGGG - Intergenic
1183609999 22:38894440-38894462 AACAGTGCCTGGTGTGCAGTAGG + Intergenic
1183739132 22:39660483-39660505 CACAGATCCAGGTGGGCAGAGGG + Intronic
1183740795 22:39667387-39667409 CACAGTGGCAGGAGCGCAGAGGG + Intronic
1184100186 22:42338011-42338033 CACAGTGACTGGTGGAGAAAGGG - Intronic
1184309764 22:43633716-43633738 CCCACGGTGTGGTGGGCAGATGG + Intronic
1184650423 22:45917071-45917093 CACAGTGCCCAGTGGGCAGGTGG - Intergenic
1184900913 22:47445879-47445901 GGCAGTGTCTGTGGGGCAGATGG + Intergenic
1185082612 22:48718239-48718261 CCCAGTGTCTGCTGTGCAGGGGG - Intronic
1185285074 22:49996455-49996477 CTCAGTGGCTGGTGGGCAAAGGG + Exonic
949432612 3:3993917-3993939 CAAAATGTCTGTTGGGAAGAGGG + Intronic
949584933 3:5428162-5428184 CTCTGTGTCTGCGGGGCAGAAGG - Intergenic
950406512 3:12808411-12808433 CACAGGGCCTGGTGTGCAGTAGG - Intronic
950428950 3:12939956-12939978 CACAGTGTCTGGTGCATAGTGGG + Intronic
952943379 3:38459710-38459732 CTCAGGGTGTGGTGGCCAGATGG + Intronic
953366699 3:42351533-42351555 CACAGTGTTTTAAGGGCAGAAGG + Intergenic
953430501 3:42835889-42835911 CCCAGGCTCGGGTGGGCAGAAGG - Intronic
953548137 3:43879448-43879470 CACAGTGTGTGGGTGGGAGAAGG - Intergenic
953552971 3:43918694-43918716 CACACTGTCTTCTGGGCAGGAGG - Intergenic
953708026 3:45245778-45245800 CAGAGTGTCTGCTGGCCACATGG + Intergenic
954794016 3:53152316-53152338 CACAGGGTCTGATGGGAGGATGG - Intergenic
955052014 3:55421873-55421895 CCCATTCTCTGGTGGGTAGACGG - Intergenic
955801232 3:62688828-62688850 CAGAGTGTCTGGGTGGCAGAAGG + Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957414421 3:79882810-79882832 CACAGTGGCAGGTGGCCAGGTGG + Intergenic
957702187 3:83728242-83728264 CTCATAGTTTGGTGGGCAGAAGG - Intergenic
958587850 3:96114492-96114514 CCCAGTGTCTGCTGGGCTGCTGG + Intergenic
960964082 3:123092464-123092486 CATGGTGGCTGCTGGGCAGAGGG + Intronic
961535821 3:127569899-127569921 CACAGTGTCAGGAGGTCAGAGGG + Intergenic
962178870 3:133184067-133184089 CCCGGTGTCTGGTGGGGAGTTGG - Intronic
962996320 3:140632529-140632551 CAAAATATCTGGTGGACAGAAGG - Intergenic
965470612 3:169085727-169085749 TCCAGTGTCTGCTGAGCAGAAGG + Intronic
966621164 3:181965797-181965819 CACAGTGTCTGGTACACAGTAGG + Intergenic
967069087 3:185946430-185946452 CACAGTCTCTGGTCCTCAGATGG - Intergenic
967531985 3:190558923-190558945 CACAGTTTCTGTGGGTCAGAAGG + Intronic
968415339 4:427743-427765 CATAGTGTCTGGTGACCAGAAGG - Intronic
969049400 4:4362033-4362055 CACAGTGTCAGGTGGGGAAGTGG + Intronic
969564539 4:7970328-7970350 CAAAGGTGCTGGTGGGCAGAGGG + Intronic
970319862 4:14864425-14864447 CACAGTGCCTGGTTGTCAGTGGG + Intergenic
971141323 4:23928239-23928261 CACAATTTCTGGTGGGAAAATGG + Intergenic
971896707 4:32605733-32605755 CACAGAGTCTGGTGTGGGGATGG + Intergenic
972782328 4:42296886-42296908 CTCAGTGCCTGGTGAGCAAATGG - Intergenic
974507621 4:62797249-62797271 GACAATGTCTGGTGAGCTGATGG + Intergenic
975010412 4:69343744-69343766 CACAGTGTTTTGTGTGCATAAGG + Intronic
978328388 4:107585175-107585197 CACTGGGTCTGTTGGGCAGGGGG + Intergenic
978676408 4:111324302-111324324 CACAGTGTGTGGTGGTGTGAGGG + Intergenic
979456406 4:120930392-120930414 CCCAGTTTCTGGTGGCCAGAAGG - Intergenic
980457148 4:133059246-133059268 CACATTGTTTGGGGAGCAGAAGG - Intergenic
980988630 4:139719017-139719039 CACAGGGCATGCTGGGCAGAGGG + Exonic
981710341 4:147703324-147703346 CACCGTGTCTGGTCGACAGTTGG - Intergenic
982101099 4:151968824-151968846 CACAGGGCCTGGTGAACAGATGG - Intergenic
982209865 4:153025539-153025561 CTCAGTGTCTCATGAGCAGAAGG + Intergenic
982222297 4:153135325-153135347 CACAGTGTCTGGTACACAGTAGG - Intergenic
984200099 4:176708847-176708869 CAGAGTGTCTGGTATCCAGAAGG - Intronic
984474427 4:180217613-180217635 GACAGTGGCTGATGAGCAGATGG - Intergenic
985711984 5:1434503-1434525 CAGCCTGACTGGTGGGCAGATGG + Intronic
986007711 5:3681937-3681959 CACCGTGGGTGGTGGGCTGATGG + Intergenic
986019073 5:3784127-3784149 CACAGTGTCTGGGGAAGAGACGG + Intergenic
986350834 5:6878142-6878164 GTGAGTGCCTGGTGGGCAGAGGG + Intergenic
988990115 5:36662319-36662341 CAAAGTGTGTGTTGGGCAGTGGG - Intronic
989178525 5:38554314-38554336 AACAGTGTATGCTGGGGAGAAGG + Intronic
989998652 5:50865934-50865956 CAAATTGTCTTGTGGGCACATGG + Intergenic
990796289 5:59544688-59544710 CACAGTGAGTAGTGGGGAGAAGG + Intronic
991042314 5:62188610-62188632 CCCAGTGTCTGCTCTGCAGATGG + Intergenic
992409926 5:76495420-76495442 CTCAGTTCCTGGAGGGCAGAGGG + Intronic
992786811 5:80177796-80177818 CACAGTGTCTGGTGGGCAGATGG + Intronic
993134584 5:83942930-83942952 GACAGTGTTTGGTAGGCACAGGG + Exonic
994236502 5:97369241-97369263 CGCAGTGGTTGATGGGCAGATGG + Intergenic
996228329 5:121029989-121030011 CACAGACTGTGGTGGGCGGATGG + Intergenic
996283946 5:121766782-121766804 CACAGTGTCCTGTGGGTACATGG + Intergenic
996620308 5:125493348-125493370 CAAAGTGGCTGGTGCGCAGGAGG + Intergenic
996792903 5:127312256-127312278 CACAGTGGCTTGTGGGCACCAGG + Intronic
997305948 5:132836575-132836597 CACAGAGACTGGTGGGCAAAGGG - Intergenic
997454416 5:134006272-134006294 CACTGAGACTGGTGGGCAGGGGG + Intergenic
997762547 5:136463476-136463498 CACAGTGATTGGAGGTCAGAGGG - Intergenic
997890402 5:137671424-137671446 CTCATAGACTGGTGGGCAGACGG - Intronic
998595723 5:143528056-143528078 CACAGTGTCTGGGGCCCAGCTGG + Intergenic
999605701 5:153313171-153313193 CACAGTGACTGGTTTCCAGAAGG + Intergenic
1002322582 5:178384518-178384540 CACAGTGCCCGGTGGGCCGCTGG - Intronic
1003350567 6:5313906-5313928 CACAATGTCTGGGGCACAGAAGG - Intronic
1003566985 6:7230339-7230361 CACGGTGTCCGGGGCGCAGAAGG - Exonic
1003701000 6:8465273-8465295 CACAGTGTCTGGCAGGTAGCAGG - Intergenic
1005854783 6:29852696-29852718 CATGGTGGCTGGTGGGCACAGGG - Intergenic
1006884600 6:37370620-37370642 CTCAGGGCTTGGTGGGCAGAGGG - Intronic
1006897938 6:37482646-37482668 GACAGTGTGTGGTGGGGGGATGG + Intronic
1007507984 6:42351812-42351834 CCCTGTGTCTGTTTGGCAGATGG - Intronic
1010850296 6:80767452-80767474 CACAGTGTCTGGAGGACAGTAGG - Intergenic
1011755468 6:90494338-90494360 GAGAGTGTGAGGTGGGCAGAGGG - Intergenic
1011862750 6:91781132-91781154 TAAAGTGTCTGGTGGGTAAAGGG - Intergenic
1012279619 6:97313371-97313393 CACAGTGTCTGCTGTACAGCAGG + Intergenic
1013658497 6:112270384-112270406 CAGTGTGTCTGGTGGGCAGCTGG + Intergenic
1015502045 6:133944898-133944920 CACTGTGATTGGTGGGAAGAAGG - Intergenic
1016030348 6:139331065-139331087 AACAGTGTCCAGTGGTCAGATGG + Intergenic
1016123571 6:140373749-140373771 CAGGGTGGCTGCTGGGCAGAGGG + Intergenic
1016317421 6:142805929-142805951 CACAATTTCTGCAGGGCAGACGG - Intronic
1016988861 6:149915873-149915895 CACAGTAGGTGGTGGGCAGGTGG + Intergenic
1016998672 6:149979478-149979500 CACAGTACGTGGTGGGCAGGTGG - Intergenic
1017598340 6:156054029-156054051 GACAGTGACTCGTGGGCAGATGG - Intergenic
1017708566 6:157147060-157147082 CACAGTGTGTGCTGGGCACTTGG - Intronic
1018379526 6:163245673-163245695 CAGAGTGTGTGGTGGGGAGAGGG - Intronic
1018719865 6:166564362-166564384 CCCAGAGACTGGTGGGGAGAGGG - Intronic
1019232771 6:170582713-170582735 CACAGTGTCGGGCACGCAGAAGG - Intronic
1019413289 7:915965-915987 GACAGTGTCTCGTGGGCAGTGGG - Intronic
1020800203 7:12723689-12723711 CTGAGTGGCTGATGGGCAGAAGG - Intergenic
1021687971 7:23206050-23206072 CCCCGTGTCTGCAGGGCAGAGGG - Intergenic
1021969399 7:25951490-25951512 GGCAGAGGCTGGTGGGCAGAAGG - Intergenic
1022205190 7:28157136-28157158 CAGAGTGTCTGCTGGGCAAATGG + Intronic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1022941411 7:35243865-35243887 CACAGTCTCCTGTGGGCAGAGGG + Intronic
1023167527 7:37357416-37357438 CACAGCTTCTGGGGGGCAGCTGG - Intronic
1023661413 7:42474840-42474862 GACAGTGTCAGGTGGGAAGGAGG + Intergenic
1024224997 7:47319769-47319791 CACATGGGCTGGTGGGCATAAGG - Intronic
1024229738 7:47354943-47354965 CCCAGTGTCTGGAGGGAAGGAGG - Intronic
1024317186 7:48032089-48032111 GCCAGTGGCTGATGGGCAGAGGG + Intergenic
1027952767 7:84839006-84839028 TACAGTGTCAGCTAGGCAGAAGG + Intergenic
1031033608 7:116762819-116762841 CACAGTTTATGCTGGGCAGGTGG + Intronic
1032253536 7:130278569-130278591 CACAGTGTCTGCAACGCAGAAGG + Intronic
1032381764 7:131491784-131491806 CACAGTATTTGGTGGATAGAAGG - Exonic
1032465429 7:132141445-132141467 CACAGTTCCTGGTGGGCAGGAGG - Intronic
1032499616 7:132390707-132390729 GAGAGTGGTTGGTGGGCAGAAGG - Intronic
1033011344 7:137625854-137625876 CACAGAGTCTAGTGGGCCGAAGG - Intronic
1033011416 7:137626483-137626505 CACAGAGTCTAGTGGGCCAAAGG + Intronic
1033285939 7:140040471-140040493 GACAGTGTCTGTTGGTCAGCTGG - Intronic
1035211540 7:157332319-157332341 CACAGAGGCTGCAGGGCAGAGGG - Intergenic
1035244128 7:157551462-157551484 CACAGTGTCTGTGGGGTACATGG - Intronic
1036450692 8:8864654-8864676 AAAAGTGTCTGGTGGGTAGCTGG - Intronic
1037771850 8:21805912-21805934 CCCAGTGGCTGCAGGGCAGAAGG + Intronic
1037782094 8:21876770-21876792 CACAGTCTCTGATAGGCTGAAGG + Intergenic
1037833768 8:22204336-22204358 CACTATGACTGGTGGGGAGAAGG - Intronic
1037838146 8:22226727-22226749 CACGCTGCCTGGTGGACAGAAGG + Intronic
1037855116 8:22366423-22366445 CACAGTGACTGGTCCCCAGACGG - Intergenic
1037974316 8:23199257-23199279 CACAGTGTCTGCTGGTGAGTTGG - Exonic
1038198825 8:25392781-25392803 CACATCGTCTGGTGGCAAGAAGG - Exonic
1039823508 8:41154373-41154395 CACAGCCTCTGGTGAGCAGATGG + Intergenic
1040489512 8:47906590-47906612 CACTGTGTCTGGAGTGCAGTGGG - Intronic
1040785472 8:51159163-51159185 CAGAGTGGCTGCCGGGCAGAGGG - Intergenic
1041348339 8:56924172-56924194 GACAGGGGCTAGTGGGCAGAGGG - Intergenic
1044562883 8:93630634-93630656 CCCAGTGTCTGGTAGGCAGTAGG - Intergenic
1044921489 8:97174126-97174148 AACAGTGTCTTGATGGCAGAAGG + Intergenic
1044926449 8:97213426-97213448 CACAGTGTGGGGTGGGGAGGGGG + Intergenic
1045065108 8:98437419-98437441 CCCAGGGACTGCTGGGCAGATGG - Intronic
1047533238 8:125696259-125696281 CACAGTGTCTGGTGCACAGCAGG + Intergenic
1048356126 8:133655219-133655241 CACAGTCTGTGCAGGGCAGAGGG + Intergenic
1048455033 8:134570009-134570031 CACAGTGGCTGCAGGGCACAGGG + Intronic
1048817928 8:138351352-138351374 CACAGAGGCTGATGTGCAGAGGG + Intronic
1048829783 8:138464846-138464868 GACACTGTCTGTTGTGCAGAGGG - Intronic
1049340598 8:142110380-142110402 CACTGTGTCTTTTGGTCAGAGGG - Intergenic
1051680494 9:19602862-19602884 CCCAGTGTCTGGCAGGCACATGG + Intronic
1053421740 9:37984113-37984135 AACAGTGCCTGGTGCACAGAAGG + Intronic
1053601619 9:39616632-39616654 CACAGTGCCTGGCTGACAGACGG + Intergenic
1053859267 9:42370398-42370420 CACAGTGCCTGGCTGACAGATGG + Intergenic
1054251914 9:62725814-62725836 CACAGTGCCTGGCTGACAGATGG - Intergenic
1054566029 9:66760315-66760337 CACAGTGCCTGGCTGACAGATGG - Intergenic
1054718648 9:68582019-68582041 CACAGTGCCTGGTGCATAGAAGG - Intergenic
1055486943 9:76765537-76765559 CACACTGTCTGATGGGGAGGTGG + Intronic
1055660977 9:78503805-78503827 GACAGTGCCTTGTGGGGAGAGGG + Intergenic
1056487028 9:87069410-87069432 CACAGTGTCTGGAAGACAGAAGG + Intergenic
1057311611 9:93946566-93946588 CACAGTGTCTGGCACGCAGAGGG + Intergenic
1057488143 9:95502173-95502195 CACAGGGGCTGGAGGGGAGAGGG - Intronic
1058650566 9:107172032-107172054 CACAGTGGCTGCTGGGGTGATGG + Intergenic
1059263230 9:112999721-112999743 CACAGGGCAAGGTGGGCAGAAGG + Intergenic
1059331440 9:113538173-113538195 CACAGTGCCTGGTATGCAGTAGG + Intronic
1060976957 9:127770565-127770587 AACAGTCCCTGGAGGGCAGATGG + Intronic
1060989567 9:127840652-127840674 CATAGCATCTGGTGTGCAGAGGG - Intronic
1061056648 9:128226225-128226247 CACAGCCTCCCGTGGGCAGAAGG + Intronic
1061872470 9:133528209-133528231 CCCAGAGTCTGGAGGGCATATGG - Intronic
1062014889 9:134286458-134286480 GGCACTGTCTGGGGGGCAGACGG - Intergenic
1062113841 9:134797007-134797029 CACAGTGGCCGGTGGGTGGAGGG + Intronic
1062396471 9:136354849-136354871 CACAGGGTGTGGTGGGCACAGGG + Intronic
1186054623 X:5636169-5636191 CACACAGGCTGGTGTGCAGAGGG - Intergenic
1186921383 X:14285091-14285113 CACAGTGCTTGGTGCACAGAAGG - Intergenic
1189996334 X:46642385-46642407 CACAGTTTCAGGTCTGCAGAGGG - Intronic
1190342480 X:49308582-49308604 CAGAGTGGCTGGGGGGCAGCAGG + Intronic
1192811430 X:74550472-74550494 CACTGTCTCTGGTGGCCAGCAGG - Intergenic
1192898554 X:75470691-75470713 TACAGTGTCTGGTGTCCAGTGGG + Intronic
1195761249 X:108248770-108248792 CACAGTGAGAGGTGAGCAGAGGG + Intronic
1195914846 X:109925957-109925979 CATGGTGCCTGGTGGACAGAAGG + Intergenic
1196778534 X:119362148-119362170 CAGGGTGGCTGCTGGGCAGAGGG - Intergenic
1196782989 X:119399572-119399594 CACCGGGTGTGGCGGGCAGAGGG + Exonic
1196858098 X:120002058-120002080 CACCTTATCTGCTGGGCAGACGG - Intergenic
1198787451 X:140304233-140304255 CACTGTGTCTGGTGGGTGGGTGG - Intergenic
1200252180 X:154559568-154559590 CCCAGGCTCTGATGGGCAGAGGG + Intronic
1200265588 X:154644848-154644870 CCCAGGCTCTGATGGGCAGAGGG - Intergenic