ID: 992796212

View in Genome Browser
Species Human (GRCh38)
Location 5:80256655-80256677
Sequence AAACATATCAATATTCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992796212_992796214 0 Left 992796212 5:80256655-80256677 CCTTCCTGAATATTGATATGTTT No data
Right 992796214 5:80256678-80256700 TCCAGCCTCTCCTCCTGCGCTGG No data
992796212_992796217 7 Left 992796212 5:80256655-80256677 CCTTCCTGAATATTGATATGTTT No data
Right 992796217 5:80256685-80256707 TCTCCTCCTGCGCTGGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992796212 Original CRISPR AAACATATCAATATTCAGGA AGG (reversed) Intergenic
No off target data available for this crispr