ID: 992798414

View in Genome Browser
Species Human (GRCh38)
Location 5:80273844-80273866
Sequence CACCTCAGTCTCCTGTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992798409_992798414 -5 Left 992798409 5:80273826-80273848 CCTCCCTCTGTGGTCTTCCACCT No data
Right 992798414 5:80273844-80273866 CACCTCAGTCTCCTGTAGCTGGG No data
992798404_992798414 30 Left 992798404 5:80273791-80273813 CCTAGGCTGGATTCGAACTTATG No data
Right 992798414 5:80273844-80273866 CACCTCAGTCTCCTGTAGCTGGG No data
992798408_992798414 -1 Left 992798408 5:80273822-80273844 CCATCCTCCCTCTGTGGTCTTCC No data
Right 992798414 5:80273844-80273866 CACCTCAGTCTCCTGTAGCTGGG No data
992798410_992798414 -8 Left 992798410 5:80273829-80273851 CCCTCTGTGGTCTTCCACCTCAG No data
Right 992798414 5:80273844-80273866 CACCTCAGTCTCCTGTAGCTGGG No data
992798411_992798414 -9 Left 992798411 5:80273830-80273852 CCTCTGTGGTCTTCCACCTCAGT No data
Right 992798414 5:80273844-80273866 CACCTCAGTCTCCTGTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992798414 Original CRISPR CACCTCAGTCTCCTGTAGCT GGG Intergenic
No off target data available for this crispr