ID: 992798721

View in Genome Browser
Species Human (GRCh38)
Location 5:80276515-80276537
Sequence CTAGTTTACCTGCACACAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992798717_992798721 -4 Left 992798717 5:80276496-80276518 CCCTTAAGAGCATTTATTTCTAG No data
Right 992798721 5:80276515-80276537 CTAGTTTACCTGCACACAAGGGG No data
992798716_992798721 6 Left 992798716 5:80276486-80276508 CCTTGCTGTTCCCTTAAGAGCAT No data
Right 992798721 5:80276515-80276537 CTAGTTTACCTGCACACAAGGGG No data
992798718_992798721 -5 Left 992798718 5:80276497-80276519 CCTTAAGAGCATTTATTTCTAGT No data
Right 992798721 5:80276515-80276537 CTAGTTTACCTGCACACAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992798721 Original CRISPR CTAGTTTACCTGCACACAAG GGG Intergenic
No off target data available for this crispr