ID: 992803915

View in Genome Browser
Species Human (GRCh38)
Location 5:80318334-80318356
Sequence GACTACTCACAGATACAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992803915_992803925 30 Left 992803915 5:80318334-80318356 CCCTGCTGTATCTGTGAGTAGTC No data
Right 992803925 5:80318387-80318409 AAAGATGAGCATGAGGCTCTGGG No data
992803915_992803923 23 Left 992803915 5:80318334-80318356 CCCTGCTGTATCTGTGAGTAGTC No data
Right 992803923 5:80318380-80318402 CTGGCTGAAAGATGAGCATGAGG No data
992803915_992803919 4 Left 992803915 5:80318334-80318356 CCCTGCTGTATCTGTGAGTAGTC No data
Right 992803919 5:80318361-80318383 ACGATGGCCTGGAGCCCAGCTGG No data
992803915_992803924 29 Left 992803915 5:80318334-80318356 CCCTGCTGTATCTGTGAGTAGTC No data
Right 992803924 5:80318386-80318408 GAAAGATGAGCATGAGGCTCTGG No data
992803915_992803918 -7 Left 992803915 5:80318334-80318356 CCCTGCTGTATCTGTGAGTAGTC No data
Right 992803918 5:80318350-80318372 AGTAGTCAGTGACGATGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992803915 Original CRISPR GACTACTCACAGATACAGCA GGG (reversed) Intergenic
No off target data available for this crispr