ID: 992804132

View in Genome Browser
Species Human (GRCh38)
Location 5:80320246-80320268
Sequence TTAACGGTTTTGGAGATGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992804132_992804142 17 Left 992804132 5:80320246-80320268 CCCACCATCTCCAAAACCGTTAA 0: 1
1: 0
2: 0
3: 15
4: 156
Right 992804142 5:80320286-80320308 ATCAAGAATATCTGGACCCTAGG 0: 1
1: 0
2: 0
3: 38
4: 147
992804132_992804140 9 Left 992804132 5:80320246-80320268 CCCACCATCTCCAAAACCGTTAA 0: 1
1: 0
2: 0
3: 15
4: 156
Right 992804140 5:80320278-80320300 TGATCCTCATCAAGAATATCTGG 0: 1
1: 0
2: 0
3: 8
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992804132 Original CRISPR TTAACGGTTTTGGAGATGGT GGG (reversed) Exonic
903335948 1:22624695-22624717 GTAACAGTTCTGGAGATGGACGG + Intergenic
905382292 1:37571569-37571591 TTAAGGGTTTTGGAGTGGGCTGG - Intronic
905443892 1:38012342-38012364 TTAACAGTTTTGGGGCTGGCTGG - Intronic
906635875 1:47410160-47410182 ATAAAGGTCTTGGAGATGGAAGG + Intergenic
909768140 1:79384111-79384133 CTAAGGGTTTTGGAAATGGAAGG + Intergenic
910059934 1:83078376-83078398 TTAACTGTAGTGGTGATGGTGGG - Intergenic
910343469 1:86214055-86214077 TTCACGGTTCTGCAGAGGGTAGG - Intergenic
914732724 1:150386141-150386163 TTTACTTTTTTTGAGATGGTGGG + Intronic
916208490 1:162338594-162338616 TTAACGACTTTGTAGTTGGTTGG - Intronic
916298700 1:163249422-163249444 TTAACGGTTTGGCAAAAGGTTGG - Intronic
916402643 1:164465785-164465807 CTTACGGTTGTGGAGATGGAGGG + Intergenic
922517846 1:226222056-226222078 TTGGCTGTTTTGGAGATGCTGGG + Intergenic
922980164 1:229818867-229818889 TTAACTGTCTTGGTGCTGGTGGG - Intergenic
923249187 1:232163559-232163581 ATAAAAGTTTTGGAGATGGACGG + Intergenic
923712953 1:236401652-236401674 TTAACGCTTTTGGGGATGTCGGG + Intronic
923915649 1:238500855-238500877 TAAGCGGTTTTGGCGAGGGTAGG - Intergenic
1063055167 10:2496421-2496443 TTAACAGTTTTGAGGAGGGTTGG - Intergenic
1063401531 10:5750952-5750974 TTAACAGTTTTGAAGACTGTAGG + Intronic
1066548060 10:36523306-36523328 TTAAAGGTTTTGGAGATTTTAGG - Exonic
1069795263 10:71047770-71047792 CTCACGGTTCTGGAGATGGGGGG - Intergenic
1075507323 10:123035802-123035824 TTACTGGTTTTGAAGATGGAGGG - Intronic
1075602802 10:123783020-123783042 TAAACTGTCTTGGAGCTGGTGGG - Intronic
1076601244 10:131658289-131658311 TTAACGGTGTTGGAGTCTGTTGG - Intergenic
1079814820 11:25042309-25042331 TTAACTGTTTTGTAAATGGATGG - Intronic
1080922799 11:36725687-36725709 TGAACAGCTCTGGAGATGGTGGG + Intergenic
1081953114 11:47063416-47063438 TAAAGAGTTTTGGAGATGGAGGG - Intronic
1083030621 11:59588592-59588614 TCAAGAGTTTTGGAGATGGAGGG + Intronic
1086186791 11:84027097-84027119 ACAAAGGTATTGGAGATGGTGGG + Intronic
1088392151 11:109326360-109326382 TTTACCTTTTTGGAGATGATGGG + Intergenic
1089861748 11:121596313-121596335 TCTACGGGTTTGGAGTTGGTGGG + Intronic
1090636116 11:128691603-128691625 TTCATGGTTTTGGAGATGGGCGG - Intronic
1092829358 12:12428954-12428976 TTAATGGTATTGGAGTTGGTAGG + Intronic
1092862156 12:12727893-12727915 TTAAAGGTTTCAGAGATGCTAGG - Intronic
1094188375 12:27669896-27669918 TGTAGGGTTTTTGAGATGGTTGG + Intronic
1095361532 12:41346712-41346734 TCAATGGTTTTGGAAATGTTTGG + Intronic
1097649020 12:62272643-62272665 TAAAAGGTTTTGGAGTTGGCAGG - Intronic
1100912965 12:99386656-99386678 TTAATGATTTTGGAAATGCTGGG + Intronic
1107542971 13:41410354-41410376 TTAAGGGTAGTGGAGATGGGTGG + Intergenic
1108311534 13:49196522-49196544 TTAAAGGTACGGGAGATGGTAGG - Intronic
1112825224 13:103384125-103384147 TTATCTGTAGTGGAGATGGTAGG + Intergenic
1112992057 13:105525859-105525881 TTAATAGTTTTGAAGATGGCGGG - Intergenic
1116042711 14:39704555-39704577 TTAAAGATTTTGGAGAGAGTTGG - Intergenic
1118711736 14:68525170-68525192 TTATCAGCTTTGGAGATGGAAGG + Intronic
1119030712 14:71190066-71190088 TGAAAAATTTTGGAGATGGTTGG + Intergenic
1119219703 14:72896351-72896373 TAAACAGTTTTGGAGAAGTTTGG + Intergenic
1119463793 14:74835953-74835975 TTAACTGTTTTGGGGAGGGAGGG + Exonic
1120483346 14:85080428-85080450 ATAACGTTTTTGGAGATGGATGG - Intergenic
1120662272 14:87264477-87264499 TAAACTGTTATGGAGCTGGTGGG + Intergenic
1125252582 15:37722788-37722810 TTAACCTTTTTGCTGATGGTGGG + Intergenic
1127522877 15:59760613-59760635 TAAACTGTCTTGGAGCTGGTGGG - Intergenic
1127923473 15:63514383-63514405 TTAATGGTTTTGGAGTTTGCAGG + Intronic
1127948162 15:63776236-63776258 CTAACAGTTTTGGTTATGGTTGG + Intronic
1131293985 15:91131099-91131121 GGAAGGGTTTTGGAGATGGGGGG + Intronic
1131414491 15:92241915-92241937 TTAACGGTTTGGGAAATTGACGG - Intergenic
1133665676 16:7965620-7965642 TTTACGGTTTTGCAGATCTTAGG - Intergenic
1134113622 16:11531780-11531802 TCAGCGGTTTTGGGGTTGGTGGG - Intergenic
1134199898 16:12189384-12189406 TTGACGTTTTTGAAGATGATAGG + Intronic
1135595647 16:23740844-23740866 TTAACGGTATTGTAAATGGAGGG - Intergenic
1137793091 16:51191511-51191533 TGAGTGGTTATGGAGATGGTGGG + Intergenic
1139611196 16:68060168-68060190 TTAAGGGCTTGGGAGATGGTGGG + Intronic
1142188716 16:88707120-88707142 CTCACGGCTTTGGAGATGGGAGG - Exonic
1142833474 17:2566668-2566690 TTGATGGTTTTGAAGATGGAAGG + Intergenic
1142968075 17:3593323-3593345 TTAAGTGATTTGGAGCTGGTTGG + Intronic
1143240231 17:5437695-5437717 TTAACAGTTTAGGAGATGATGGG + Intronic
1144512954 17:15893191-15893213 TAACCGGTTTTGGAGATGCTTGG + Intergenic
1145111875 17:20170870-20170892 TCAAGGGCTTTGGAGGTGGTTGG - Intronic
1145123979 17:20285448-20285470 TAACCAGTTTTGGAGATGGTTGG + Intronic
1146919380 17:36700109-36700131 TTAAGGGTTTTGGAGGTGGAAGG - Intergenic
1147224610 17:38967076-38967098 TTTGCGGCTTTGGAGATGTTTGG - Intronic
1148385276 17:47229877-47229899 AAAACGGTGTTGGAGATGGCTGG + Intergenic
1150275097 17:63892130-63892152 AAAAGGGTTCTGGAGATGGTTGG - Intergenic
1150277235 17:63906891-63906913 AAAAGGGTTCTGGAGATGGTTGG - Intergenic
1154069414 18:11140051-11140073 TTAACTGCATTGGGGATGGTTGG - Intronic
1157491127 18:48124581-48124603 TGCAGGGGTTTGGAGATGGTGGG + Intronic
1159161904 18:64653331-64653353 TTAAGGGTGGTGGAGATGATTGG + Intergenic
1159268591 18:66118628-66118650 TTAATGATTTTGGAGAAGATTGG - Intergenic
1163336786 19:16678070-16678092 GAAAGAGTTTTGGAGATGGTTGG + Intronic
1163835850 19:19573385-19573407 GAAACAGTTTTGGAGAAGGTGGG - Intronic
1164011923 19:21211026-21211048 TTTACTGCCTTGGAGATGGTGGG - Intergenic
1164871728 19:31651107-31651129 GAAAAGGTTTTGGAGATGGATGG + Intergenic
1164892981 19:31840681-31840703 TAAATGGTTTTGATGATGGTGGG - Intergenic
1167374706 19:49104461-49104483 TCACCGGTTTGGGAGAGGGTTGG + Intronic
925608453 2:5683180-5683202 TTCAGGCTTTTGGAGATGTTGGG - Intergenic
927958381 2:27224133-27224155 TTAAGGGTATTGGGGATGGGTGG + Intronic
934093187 2:88572553-88572575 TTAAGTCTTTTGGAGTTGGTGGG - Intronic
935856666 2:107282135-107282157 GTAAGGGTTTTGGAGGAGGTAGG - Intergenic
937732196 2:125246668-125246690 TTACTGGCTTTGAAGATGGTGGG - Intergenic
937924089 2:127154319-127154341 TTCAAGTTTTTGGAGATGGTGGG + Intergenic
938248185 2:129794978-129795000 GTACAGTTTTTGGAGATGGTGGG + Intergenic
938589810 2:132725664-132725686 ATAATGGTTTTGGAGCTGGAAGG - Exonic
944242231 2:197498158-197498180 TAAAAAGTTTTGGAGATGGATGG + Intronic
947150753 2:227112659-227112681 ATAAGAGTTTTGGAGATGGATGG - Intronic
947346904 2:229201213-229201235 TGAACAGTTCTGGAGATGGTTGG - Intronic
1169670707 20:8098137-8098159 TTAACTGAATGGGAGATGGTGGG - Intergenic
1171017189 20:21552767-21552789 TGAAAGGTTCTGGAGATGGACGG - Intergenic
1172263407 20:33589299-33589321 TTATCTGTTGTGGAGATGTTTGG + Intronic
1174344294 20:49918506-49918528 TTAACTGTTTTGTAGAGGGAGGG + Intergenic
1176152733 20:63600780-63600802 TTGACGTTTTTGGAGCTTGTGGG + Intronic
1182760252 22:32716943-32716965 GAAACAGTTTTGGAGATGGATGG - Intronic
951808679 3:26676012-26676034 TTAACGTTTTTGAAGAGTGTTGG + Intronic
953655139 3:44845400-44845422 GAAGCAGTTTTGGAGATGGTGGG + Intronic
956028023 3:65004679-65004701 TGAACTGTTTTGGAGAAAGTAGG - Intergenic
956750278 3:72339697-72339719 TTAATGGTTTTGGGAAGGGTAGG - Intergenic
957311056 3:78519491-78519513 TTGATGGTTTTGCAGATGGAAGG - Intergenic
957888046 3:86316367-86316389 TTAAGGCTTTTGGAGTTGTTAGG + Intergenic
962339399 3:134569241-134569263 TTAAGACTTTTGGAGATTGTTGG - Intronic
964695315 3:159501378-159501400 TTAAAAGGTTTGGAGATGGCAGG - Intronic
966113635 3:176433854-176433876 TTAACTGTTTTAGATATGTTGGG + Intergenic
967216572 3:187215661-187215683 TTAACAGTTTTGATGAGGGTTGG + Intergenic
970122567 4:12773111-12773133 ATAACTGTTATGAAGATGGTAGG + Intergenic
973305835 4:48648440-48648462 TTAACAGTTTGGGAGATAGGTGG - Intronic
979711457 4:123784804-123784826 TTAAAAGTTTTGGAGATAGTTGG + Intergenic
981047985 4:140282851-140282873 TTAAAGGTTTTGGAGTTGGGTGG + Intronic
981178736 4:141714338-141714360 TTAAGGATTTTGGAGGGGGTGGG - Intronic
983923211 4:173370088-173370110 CAAACGGTTTTGGAGAAGGGCGG - Intronic
986485957 5:8237478-8237500 TTATCGGTTCTGGGGATGGCAGG + Intergenic
988188231 5:27896158-27896180 TTAAATGTTTTGGGGATAGTAGG - Intergenic
988529266 5:32013436-32013458 ATAATGTTTTTGGTGATGGTGGG - Intronic
989004060 5:36790075-36790097 AAAACAGTTCTGGAGATGGTTGG - Intergenic
989949068 5:50275504-50275526 GTGATGGTTTTGGAGATGGGGGG - Intergenic
991288813 5:65010937-65010959 TCAAAGGTTTTGGAGGTGGCTGG + Intronic
992804132 5:80320246-80320268 TTAACGGTTTTGGAGATGGTGGG - Exonic
993941465 5:94063387-94063409 TTCACGATTTTGTTGATGGTAGG - Intronic
994565523 5:101441493-101441515 CTAACAGTTTTGGATATAGTGGG - Intergenic
994869986 5:105335446-105335468 TTAGCTGGTTTGGAGATGCTGGG + Intergenic
995092435 5:108194052-108194074 CTAAAGGCTTTGGAGAAGGTGGG - Intronic
996120082 5:119661829-119661851 AGAAATGTTTTGGAGATGGTTGG - Intergenic
998729030 5:145053239-145053261 TTAACCATTTAAGAGATGGTTGG - Intergenic
999794551 5:154976914-154976936 TTAAAAGTTCTGGAGATGGATGG - Intergenic
1000806639 5:165802410-165802432 TTAAGAGTTCTGGAGATGGATGG + Intergenic
1004659312 6:17696139-17696161 TTAACTTTTTTGGGGTTGGTTGG - Intronic
1005320835 6:24651957-24651979 TAAAAGGTTCTGGAGATGGATGG - Intronic
1015254545 6:131163133-131163155 TTACTGGTTTTGGAGGAGGTAGG + Intronic
1017484033 6:154886212-154886234 TCAAGGCTTTTGAAGATGGTAGG + Intronic
1020187721 7:5971612-5971634 TTGCTGGTTTTGGAGATGGAAGG - Intergenic
1020295196 7:6753158-6753180 TTGCTGGTTTTGGAGATGGAAGG + Intergenic
1020617050 7:10472199-10472221 TTAACGGTTTTAGAGGTGACAGG + Intergenic
1023095276 7:36654044-36654066 ATCATGGTTTTGGACATGGTGGG + Intronic
1023928067 7:44685201-44685223 GAAACAGTTTTGGAGATGGGTGG - Intronic
1024661142 7:51496721-51496743 TTAATGGTCTTGGAGATCCTGGG + Intergenic
1024742159 7:52365874-52365896 TTCAGGGATTTGGAGATGATTGG + Intergenic
1024778061 7:52811563-52811585 ATAAAGGTTTTGTGGATGGTGGG - Intergenic
1028811255 7:95089547-95089569 TTAACTGCTTTGGAGATTCTGGG + Intronic
1029987274 7:104933920-104933942 TTAAGAGATTTGGAGAGGGTGGG - Intergenic
1030053991 7:105565716-105565738 TTTAGGGTTCTGGAGATGTTTGG + Intronic
1031613997 7:123859428-123859450 TTAATGGTTTAGGAGGTGTTCGG - Intronic
1031833956 7:126659234-126659256 TTCACAATTTTGGAGATTGTAGG - Intronic
1033021839 7:137733176-137733198 TGAAAAGTTCTGGAGATGGTTGG - Intronic
1034926986 7:155130380-155130402 TAAACGTTTTTGGAGGAGGTGGG - Intergenic
1037131567 8:15413097-15413119 TTAAGGCTTTTGAAGATGTTGGG - Intergenic
1040851090 8:51900499-51900521 TGAACGCTTTTGCAGATGGTTGG - Intergenic
1042449273 8:68925436-68925458 CTGACGTTTTTGGAGATGGTTGG + Intergenic
1043001730 8:74768127-74768149 TTAACGGTTTTGAAGAGAATTGG + Intronic
1043624589 8:82240477-82240499 TTACTGGCTTTGGAGATGGAGGG + Intergenic
1047113407 8:121815950-121815972 TTACAGGTTTTGGGGATAGTCGG + Intergenic
1051599383 9:18857407-18857429 TTAACGCTTCTGAAGATGATAGG + Intronic
1052250382 9:26390804-26390826 TTAAGAGTTTGGGGGATGGTTGG + Intergenic
1053065153 9:35063111-35063133 TTTAGGGTTTGGGAGAAGGTGGG - Intronic
1054920504 9:70538299-70538321 TTAACTTTTTTAGAGATGGGGGG + Intronic
1055071691 9:72173247-72173269 TTCATGGCTTTGGAGATGGAGGG - Intronic
1057051403 9:91926893-91926915 GAAACAGTTTTGGAGATGGATGG + Intronic
1057426839 9:94958002-94958024 TTAATGGTATGGGAGATGGATGG - Intronic
1060044339 9:120327849-120327871 TTACCAGGTTTGGAGAGGGTTGG - Intergenic
1185497394 X:565851-565873 TTAATGGTTGTATAGATGGTTGG + Intergenic
1187544054 X:20230069-20230091 CAAATGGTTTTGGAGAGGGTAGG + Intronic
1188780394 X:34277078-34277100 TCAACAGATTTAGAGATGGTTGG - Intergenic
1189457221 X:41203280-41203302 TGAAGAGTTTTGGAGATGGGTGG - Intronic
1189715972 X:43866615-43866637 GCAACGGTTCTGGAGATGGATGG + Intronic
1194047956 X:89033068-89033090 TTAACACTTTGGGAGATTGTTGG - Intergenic
1197856039 X:130915056-130915078 TGAAAGGGTTTGCAGATGGTAGG + Intergenic
1199235425 X:145487291-145487313 TTAACAGTTTTGGAGACTGATGG - Intergenic
1200374450 X:155765227-155765249 TGAAGGGATTTGCAGATGGTTGG + Intergenic