ID: 992813043

View in Genome Browser
Species Human (GRCh38)
Location 5:80408299-80408321
Sequence CAGCTCCGGGGGCTCGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 119}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992813043_992813059 18 Left 992813043 5:80408299-80408321 CCTTTTCCGAGCCCCCGGAGCTG 0: 1
1: 0
2: 3
3: 10
4: 119
Right 992813059 5:80408340-80408362 TCCAATCTGATGTCCCCTCCTGG 0: 1
1: 0
2: 1
3: 10
4: 124
992813043_992813053 -8 Left 992813043 5:80408299-80408321 CCTTTTCCGAGCCCCCGGAGCTG 0: 1
1: 0
2: 3
3: 10
4: 119
Right 992813053 5:80408314-80408336 CGGAGCTGGCCGGGGAACCCTGG 0: 1
1: 0
2: 2
3: 24
4: 243
992813043_992813061 28 Left 992813043 5:80408299-80408321 CCTTTTCCGAGCCCCCGGAGCTG 0: 1
1: 0
2: 3
3: 10
4: 119
Right 992813061 5:80408350-80408372 TGTCCCCTCCTGGAGCCTGAAGG 0: 1
1: 0
2: 2
3: 27
4: 279
992813043_992813062 29 Left 992813043 5:80408299-80408321 CCTTTTCCGAGCCCCCGGAGCTG 0: 1
1: 0
2: 3
3: 10
4: 119
Right 992813062 5:80408351-80408373 GTCCCCTCCTGGAGCCTGAAGGG 0: 1
1: 0
2: 0
3: 20
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992813043 Original CRISPR CAGCTCCGGGGGCTCGGAAA AGG (reversed) Intronic