ID: 992813046

View in Genome Browser
Species Human (GRCh38)
Location 5:80408305-80408327
Sequence CCCGGCCAGCTCCGGGGGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 256}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992813046_992813061 22 Left 992813046 5:80408305-80408327 CCGAGCCCCCGGAGCTGGCCGGG 0: 1
1: 0
2: 2
3: 33
4: 256
Right 992813061 5:80408350-80408372 TGTCCCCTCCTGGAGCCTGAAGG 0: 1
1: 0
2: 2
3: 27
4: 279
992813046_992813059 12 Left 992813046 5:80408305-80408327 CCGAGCCCCCGGAGCTGGCCGGG 0: 1
1: 0
2: 2
3: 33
4: 256
Right 992813059 5:80408340-80408362 TCCAATCTGATGTCCCCTCCTGG 0: 1
1: 0
2: 1
3: 10
4: 124
992813046_992813062 23 Left 992813046 5:80408305-80408327 CCGAGCCCCCGGAGCTGGCCGGG 0: 1
1: 0
2: 2
3: 33
4: 256
Right 992813062 5:80408351-80408373 GTCCCCTCCTGGAGCCTGAAGGG 0: 1
1: 0
2: 0
3: 20
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992813046 Original CRISPR CCCGGCCAGCTCCGGGGGCT CGG (reversed) Intronic