ID: 992813049

View in Genome Browser
Species Human (GRCh38)
Location 5:80408310-80408332
Sequence GGTTCCCCGGCCAGCTCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 137}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992813049_992813061 17 Left 992813049 5:80408310-80408332 CCCCCGGAGCTGGCCGGGGAACC 0: 1
1: 0
2: 0
3: 9
4: 137
Right 992813061 5:80408350-80408372 TGTCCCCTCCTGGAGCCTGAAGG 0: 1
1: 0
2: 2
3: 27
4: 279
992813049_992813059 7 Left 992813049 5:80408310-80408332 CCCCCGGAGCTGGCCGGGGAACC 0: 1
1: 0
2: 0
3: 9
4: 137
Right 992813059 5:80408340-80408362 TCCAATCTGATGTCCCCTCCTGG 0: 1
1: 0
2: 1
3: 10
4: 124
992813049_992813062 18 Left 992813049 5:80408310-80408332 CCCCCGGAGCTGGCCGGGGAACC 0: 1
1: 0
2: 0
3: 9
4: 137
Right 992813062 5:80408351-80408373 GTCCCCTCCTGGAGCCTGAAGGG 0: 1
1: 0
2: 0
3: 20
4: 203
992813049_992813067 27 Left 992813049 5:80408310-80408332 CCCCCGGAGCTGGCCGGGGAACC 0: 1
1: 0
2: 0
3: 9
4: 137
Right 992813067 5:80408360-80408382 TGGAGCCTGAAGGGCCAGACCGG 0: 1
1: 0
2: 3
3: 82
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992813049 Original CRISPR GGTTCCCCGGCCAGCTCCGG GGG (reversed) Intronic