ID: 992813052

View in Genome Browser
Species Human (GRCh38)
Location 5:80408313-80408335
Sequence CAGGGTTCCCCGGCCAGCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 5, 3: 14, 4: 193}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992813052_992813061 14 Left 992813052 5:80408313-80408335 CCGGAGCTGGCCGGGGAACCCTG 0: 1
1: 0
2: 5
3: 14
4: 193
Right 992813061 5:80408350-80408372 TGTCCCCTCCTGGAGCCTGAAGG 0: 1
1: 0
2: 2
3: 27
4: 279
992813052_992813069 29 Left 992813052 5:80408313-80408335 CCGGAGCTGGCCGGGGAACCCTG 0: 1
1: 0
2: 5
3: 14
4: 193
Right 992813069 5:80408365-80408387 CCTGAAGGGCCAGACCGGACTGG 0: 1
1: 0
2: 1
3: 11
4: 101
992813052_992813059 4 Left 992813052 5:80408313-80408335 CCGGAGCTGGCCGGGGAACCCTG 0: 1
1: 0
2: 5
3: 14
4: 193
Right 992813059 5:80408340-80408362 TCCAATCTGATGTCCCCTCCTGG 0: 1
1: 0
2: 1
3: 10
4: 124
992813052_992813067 24 Left 992813052 5:80408313-80408335 CCGGAGCTGGCCGGGGAACCCTG 0: 1
1: 0
2: 5
3: 14
4: 193
Right 992813067 5:80408360-80408382 TGGAGCCTGAAGGGCCAGACCGG 0: 1
1: 0
2: 3
3: 82
4: 410
992813052_992813062 15 Left 992813052 5:80408313-80408335 CCGGAGCTGGCCGGGGAACCCTG 0: 1
1: 0
2: 5
3: 14
4: 193
Right 992813062 5:80408351-80408373 GTCCCCTCCTGGAGCCTGAAGGG 0: 1
1: 0
2: 0
3: 20
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992813052 Original CRISPR CAGGGTTCCCCGGCCAGCTC CGG (reversed) Intronic