ID: 992813054

View in Genome Browser
Species Human (GRCh38)
Location 5:80408323-80408345
Sequence ATTGGAGGGCCAGGGTTCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 167}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992813054_992813059 -6 Left 992813054 5:80408323-80408345 CCGGGGAACCCTGGCCCTCCAAT 0: 1
1: 0
2: 0
3: 17
4: 167
Right 992813059 5:80408340-80408362 TCCAATCTGATGTCCCCTCCTGG 0: 1
1: 0
2: 1
3: 10
4: 124
992813054_992813067 14 Left 992813054 5:80408323-80408345 CCGGGGAACCCTGGCCCTCCAAT 0: 1
1: 0
2: 0
3: 17
4: 167
Right 992813067 5:80408360-80408382 TGGAGCCTGAAGGGCCAGACCGG 0: 1
1: 0
2: 3
3: 82
4: 410
992813054_992813070 24 Left 992813054 5:80408323-80408345 CCGGGGAACCCTGGCCCTCCAAT 0: 1
1: 0
2: 0
3: 17
4: 167
Right 992813070 5:80408370-80408392 AGGGCCAGACCGGACTGGACCGG 0: 1
1: 0
2: 2
3: 11
4: 119
992813054_992813061 4 Left 992813054 5:80408323-80408345 CCGGGGAACCCTGGCCCTCCAAT 0: 1
1: 0
2: 0
3: 17
4: 167
Right 992813061 5:80408350-80408372 TGTCCCCTCCTGGAGCCTGAAGG 0: 1
1: 0
2: 2
3: 27
4: 279
992813054_992813062 5 Left 992813054 5:80408323-80408345 CCGGGGAACCCTGGCCCTCCAAT 0: 1
1: 0
2: 0
3: 17
4: 167
Right 992813062 5:80408351-80408373 GTCCCCTCCTGGAGCCTGAAGGG 0: 1
1: 0
2: 0
3: 20
4: 203
992813054_992813074 29 Left 992813054 5:80408323-80408345 CCGGGGAACCCTGGCCCTCCAAT 0: 1
1: 0
2: 0
3: 17
4: 167
Right 992813074 5:80408375-80408397 CAGACCGGACTGGACCGGGAGGG 0: 1
1: 0
2: 0
3: 5
4: 86
992813054_992813073 28 Left 992813054 5:80408323-80408345 CCGGGGAACCCTGGCCCTCCAAT 0: 1
1: 0
2: 0
3: 17
4: 167
Right 992813073 5:80408374-80408396 CCAGACCGGACTGGACCGGGAGG 0: 1
1: 0
2: 1
3: 5
4: 84
992813054_992813071 25 Left 992813054 5:80408323-80408345 CCGGGGAACCCTGGCCCTCCAAT 0: 1
1: 0
2: 0
3: 17
4: 167
Right 992813071 5:80408371-80408393 GGGCCAGACCGGACTGGACCGGG No data
992813054_992813069 19 Left 992813054 5:80408323-80408345 CCGGGGAACCCTGGCCCTCCAAT 0: 1
1: 0
2: 0
3: 17
4: 167
Right 992813069 5:80408365-80408387 CCTGAAGGGCCAGACCGGACTGG 0: 1
1: 0
2: 1
3: 11
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992813054 Original CRISPR ATTGGAGGGCCAGGGTTCCC CGG (reversed) Intronic