ID: 992813055

View in Genome Browser
Species Human (GRCh38)
Location 5:80408331-80408353
Sequence GACATCAGATTGGAGGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 242}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992813055_992813070 16 Left 992813055 5:80408331-80408353 CCCTGGCCCTCCAATCTGATGTC 0: 1
1: 0
2: 0
3: 25
4: 242
Right 992813070 5:80408370-80408392 AGGGCCAGACCGGACTGGACCGG 0: 1
1: 0
2: 2
3: 11
4: 119
992813055_992813069 11 Left 992813055 5:80408331-80408353 CCCTGGCCCTCCAATCTGATGTC 0: 1
1: 0
2: 0
3: 25
4: 242
Right 992813069 5:80408365-80408387 CCTGAAGGGCCAGACCGGACTGG 0: 1
1: 0
2: 1
3: 11
4: 101
992813055_992813062 -3 Left 992813055 5:80408331-80408353 CCCTGGCCCTCCAATCTGATGTC 0: 1
1: 0
2: 0
3: 25
4: 242
Right 992813062 5:80408351-80408373 GTCCCCTCCTGGAGCCTGAAGGG 0: 1
1: 0
2: 0
3: 20
4: 203
992813055_992813071 17 Left 992813055 5:80408331-80408353 CCCTGGCCCTCCAATCTGATGTC 0: 1
1: 0
2: 0
3: 25
4: 242
Right 992813071 5:80408371-80408393 GGGCCAGACCGGACTGGACCGGG No data
992813055_992813076 30 Left 992813055 5:80408331-80408353 CCCTGGCCCTCCAATCTGATGTC 0: 1
1: 0
2: 0
3: 25
4: 242
Right 992813076 5:80408384-80408406 CTGGACCGGGAGGGCAATCACGG No data
992813055_992813073 20 Left 992813055 5:80408331-80408353 CCCTGGCCCTCCAATCTGATGTC 0: 1
1: 0
2: 0
3: 25
4: 242
Right 992813073 5:80408374-80408396 CCAGACCGGACTGGACCGGGAGG 0: 1
1: 0
2: 1
3: 5
4: 84
992813055_992813061 -4 Left 992813055 5:80408331-80408353 CCCTGGCCCTCCAATCTGATGTC 0: 1
1: 0
2: 0
3: 25
4: 242
Right 992813061 5:80408350-80408372 TGTCCCCTCCTGGAGCCTGAAGG 0: 1
1: 0
2: 2
3: 27
4: 279
992813055_992813067 6 Left 992813055 5:80408331-80408353 CCCTGGCCCTCCAATCTGATGTC 0: 1
1: 0
2: 0
3: 25
4: 242
Right 992813067 5:80408360-80408382 TGGAGCCTGAAGGGCCAGACCGG 0: 1
1: 0
2: 3
3: 82
4: 410
992813055_992813074 21 Left 992813055 5:80408331-80408353 CCCTGGCCCTCCAATCTGATGTC 0: 1
1: 0
2: 0
3: 25
4: 242
Right 992813074 5:80408375-80408397 CAGACCGGACTGGACCGGGAGGG 0: 1
1: 0
2: 0
3: 5
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992813055 Original CRISPR GACATCAGATTGGAGGGCCA GGG (reversed) Intronic