ID: 992813057

View in Genome Browser
Species Human (GRCh38)
Location 5:80408337-80408359
Sequence GGAGGGGACATCAGATTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 255}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992813057_992813069 5 Left 992813057 5:80408337-80408359 CCCTCCAATCTGATGTCCCCTCC 0: 1
1: 0
2: 1
3: 21
4: 255
Right 992813069 5:80408365-80408387 CCTGAAGGGCCAGACCGGACTGG 0: 1
1: 0
2: 1
3: 11
4: 101
992813057_992813076 24 Left 992813057 5:80408337-80408359 CCCTCCAATCTGATGTCCCCTCC 0: 1
1: 0
2: 1
3: 21
4: 255
Right 992813076 5:80408384-80408406 CTGGACCGGGAGGGCAATCACGG No data
992813057_992813067 0 Left 992813057 5:80408337-80408359 CCCTCCAATCTGATGTCCCCTCC 0: 1
1: 0
2: 1
3: 21
4: 255
Right 992813067 5:80408360-80408382 TGGAGCCTGAAGGGCCAGACCGG 0: 1
1: 0
2: 3
3: 82
4: 410
992813057_992813062 -9 Left 992813057 5:80408337-80408359 CCCTCCAATCTGATGTCCCCTCC 0: 1
1: 0
2: 1
3: 21
4: 255
Right 992813062 5:80408351-80408373 GTCCCCTCCTGGAGCCTGAAGGG 0: 1
1: 0
2: 0
3: 20
4: 203
992813057_992813073 14 Left 992813057 5:80408337-80408359 CCCTCCAATCTGATGTCCCCTCC 0: 1
1: 0
2: 1
3: 21
4: 255
Right 992813073 5:80408374-80408396 CCAGACCGGACTGGACCGGGAGG 0: 1
1: 0
2: 1
3: 5
4: 84
992813057_992813061 -10 Left 992813057 5:80408337-80408359 CCCTCCAATCTGATGTCCCCTCC 0: 1
1: 0
2: 1
3: 21
4: 255
Right 992813061 5:80408350-80408372 TGTCCCCTCCTGGAGCCTGAAGG 0: 1
1: 0
2: 2
3: 27
4: 279
992813057_992813077 27 Left 992813057 5:80408337-80408359 CCCTCCAATCTGATGTCCCCTCC 0: 1
1: 0
2: 1
3: 21
4: 255
Right 992813077 5:80408387-80408409 GACCGGGAGGGCAATCACGGCGG 0: 1
1: 0
2: 0
3: 0
4: 42
992813057_992813074 15 Left 992813057 5:80408337-80408359 CCCTCCAATCTGATGTCCCCTCC 0: 1
1: 0
2: 1
3: 21
4: 255
Right 992813074 5:80408375-80408397 CAGACCGGACTGGACCGGGAGGG 0: 1
1: 0
2: 0
3: 5
4: 86
992813057_992813070 10 Left 992813057 5:80408337-80408359 CCCTCCAATCTGATGTCCCCTCC 0: 1
1: 0
2: 1
3: 21
4: 255
Right 992813070 5:80408370-80408392 AGGGCCAGACCGGACTGGACCGG 0: 1
1: 0
2: 2
3: 11
4: 119
992813057_992813071 11 Left 992813057 5:80408337-80408359 CCCTCCAATCTGATGTCCCCTCC 0: 1
1: 0
2: 1
3: 21
4: 255
Right 992813071 5:80408371-80408393 GGGCCAGACCGGACTGGACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992813057 Original CRISPR GGAGGGGACATCAGATTGGA GGG (reversed) Intronic