ID: 992813059

View in Genome Browser
Species Human (GRCh38)
Location 5:80408340-80408362
Sequence TCCAATCTGATGTCCCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 124}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992813043_992813059 18 Left 992813043 5:80408299-80408321 CCTTTTCCGAGCCCCCGGAGCTG 0: 1
1: 0
2: 3
3: 10
4: 119
Right 992813059 5:80408340-80408362 TCCAATCTGATGTCCCCTCCTGG 0: 1
1: 0
2: 1
3: 10
4: 124
992813038_992813059 30 Left 992813038 5:80408287-80408309 CCCCGACCGATTCCTTTTCCGAG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 992813059 5:80408340-80408362 TCCAATCTGATGTCCCCTCCTGG 0: 1
1: 0
2: 1
3: 10
4: 124
992813039_992813059 29 Left 992813039 5:80408288-80408310 CCCGACCGATTCCTTTTCCGAGC 0: 1
1: 0
2: 0
3: 5
4: 36
Right 992813059 5:80408340-80408362 TCCAATCTGATGTCCCCTCCTGG 0: 1
1: 0
2: 1
3: 10
4: 124
992813040_992813059 28 Left 992813040 5:80408289-80408311 CCGACCGATTCCTTTTCCGAGCC 0: 1
1: 0
2: 0
3: 2
4: 42
Right 992813059 5:80408340-80408362 TCCAATCTGATGTCCCCTCCTGG 0: 1
1: 0
2: 1
3: 10
4: 124
992813041_992813059 24 Left 992813041 5:80408293-80408315 CCGATTCCTTTTCCGAGCCCCCG 0: 1
1: 0
2: 1
3: 8
4: 98
Right 992813059 5:80408340-80408362 TCCAATCTGATGTCCCCTCCTGG 0: 1
1: 0
2: 1
3: 10
4: 124
992813049_992813059 7 Left 992813049 5:80408310-80408332 CCCCCGGAGCTGGCCGGGGAACC 0: 1
1: 0
2: 0
3: 9
4: 137
Right 992813059 5:80408340-80408362 TCCAATCTGATGTCCCCTCCTGG 0: 1
1: 0
2: 1
3: 10
4: 124
992813051_992813059 5 Left 992813051 5:80408312-80408334 CCCGGAGCTGGCCGGGGAACCCT 0: 1
1: 0
2: 0
3: 16
4: 173
Right 992813059 5:80408340-80408362 TCCAATCTGATGTCCCCTCCTGG 0: 1
1: 0
2: 1
3: 10
4: 124
992813050_992813059 6 Left 992813050 5:80408311-80408333 CCCCGGAGCTGGCCGGGGAACCC 0: 1
1: 0
2: 1
3: 12
4: 161
Right 992813059 5:80408340-80408362 TCCAATCTGATGTCCCCTCCTGG 0: 1
1: 0
2: 1
3: 10
4: 124
992813054_992813059 -6 Left 992813054 5:80408323-80408345 CCGGGGAACCCTGGCCCTCCAAT 0: 1
1: 0
2: 0
3: 17
4: 167
Right 992813059 5:80408340-80408362 TCCAATCTGATGTCCCCTCCTGG 0: 1
1: 0
2: 1
3: 10
4: 124
992813046_992813059 12 Left 992813046 5:80408305-80408327 CCGAGCCCCCGGAGCTGGCCGGG 0: 1
1: 0
2: 2
3: 33
4: 256
Right 992813059 5:80408340-80408362 TCCAATCTGATGTCCCCTCCTGG 0: 1
1: 0
2: 1
3: 10
4: 124
992813052_992813059 4 Left 992813052 5:80408313-80408335 CCGGAGCTGGCCGGGGAACCCTG 0: 1
1: 0
2: 5
3: 14
4: 193
Right 992813059 5:80408340-80408362 TCCAATCTGATGTCCCCTCCTGG 0: 1
1: 0
2: 1
3: 10
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992813059 Original CRISPR TCCAATCTGATGTCCCCTCC TGG Intronic