ID: 992813062

View in Genome Browser
Species Human (GRCh38)
Location 5:80408351-80408373
Sequence GTCCCCTCCTGGAGCCTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 203}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992813057_992813062 -9 Left 992813057 5:80408337-80408359 CCCTCCAATCTGATGTCCCCTCC 0: 1
1: 0
2: 1
3: 21
4: 255
Right 992813062 5:80408351-80408373 GTCCCCTCCTGGAGCCTGAAGGG 0: 1
1: 0
2: 0
3: 20
4: 203
992813049_992813062 18 Left 992813049 5:80408310-80408332 CCCCCGGAGCTGGCCGGGGAACC 0: 1
1: 0
2: 0
3: 9
4: 137
Right 992813062 5:80408351-80408373 GTCCCCTCCTGGAGCCTGAAGGG 0: 1
1: 0
2: 0
3: 20
4: 203
992813051_992813062 16 Left 992813051 5:80408312-80408334 CCCGGAGCTGGCCGGGGAACCCT 0: 1
1: 0
2: 0
3: 16
4: 173
Right 992813062 5:80408351-80408373 GTCCCCTCCTGGAGCCTGAAGGG 0: 1
1: 0
2: 0
3: 20
4: 203
992813046_992813062 23 Left 992813046 5:80408305-80408327 CCGAGCCCCCGGAGCTGGCCGGG 0: 1
1: 0
2: 2
3: 33
4: 256
Right 992813062 5:80408351-80408373 GTCCCCTCCTGGAGCCTGAAGGG 0: 1
1: 0
2: 0
3: 20
4: 203
992813052_992813062 15 Left 992813052 5:80408313-80408335 CCGGAGCTGGCCGGGGAACCCTG 0: 1
1: 0
2: 5
3: 14
4: 193
Right 992813062 5:80408351-80408373 GTCCCCTCCTGGAGCCTGAAGGG 0: 1
1: 0
2: 0
3: 20
4: 203
992813058_992813062 -10 Left 992813058 5:80408338-80408360 CCTCCAATCTGATGTCCCCTCCT 0: 1
1: 0
2: 3
3: 20
4: 251
Right 992813062 5:80408351-80408373 GTCCCCTCCTGGAGCCTGAAGGG 0: 1
1: 0
2: 0
3: 20
4: 203
992813050_992813062 17 Left 992813050 5:80408311-80408333 CCCCGGAGCTGGCCGGGGAACCC 0: 1
1: 0
2: 1
3: 12
4: 161
Right 992813062 5:80408351-80408373 GTCCCCTCCTGGAGCCTGAAGGG 0: 1
1: 0
2: 0
3: 20
4: 203
992813056_992813062 -4 Left 992813056 5:80408332-80408354 CCTGGCCCTCCAATCTGATGTCC 0: 1
1: 0
2: 1
3: 10
4: 204
Right 992813062 5:80408351-80408373 GTCCCCTCCTGGAGCCTGAAGGG 0: 1
1: 0
2: 0
3: 20
4: 203
992813055_992813062 -3 Left 992813055 5:80408331-80408353 CCCTGGCCCTCCAATCTGATGTC 0: 1
1: 0
2: 0
3: 25
4: 242
Right 992813062 5:80408351-80408373 GTCCCCTCCTGGAGCCTGAAGGG 0: 1
1: 0
2: 0
3: 20
4: 203
992813043_992813062 29 Left 992813043 5:80408299-80408321 CCTTTTCCGAGCCCCCGGAGCTG 0: 1
1: 0
2: 3
3: 10
4: 119
Right 992813062 5:80408351-80408373 GTCCCCTCCTGGAGCCTGAAGGG 0: 1
1: 0
2: 0
3: 20
4: 203
992813054_992813062 5 Left 992813054 5:80408323-80408345 CCGGGGAACCCTGGCCCTCCAAT 0: 1
1: 0
2: 0
3: 17
4: 167
Right 992813062 5:80408351-80408373 GTCCCCTCCTGGAGCCTGAAGGG 0: 1
1: 0
2: 0
3: 20
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992813062 Original CRISPR GTCCCCTCCTGGAGCCTGAA GGG Intronic