ID: 992813067

View in Genome Browser
Species Human (GRCh38)
Location 5:80408360-80408382
Sequence TGGAGCCTGAAGGGCCAGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 496
Summary {0: 1, 1: 0, 2: 3, 3: 82, 4: 410}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992813049_992813067 27 Left 992813049 5:80408310-80408332 CCCCCGGAGCTGGCCGGGGAACC 0: 1
1: 0
2: 0
3: 9
4: 137
Right 992813067 5:80408360-80408382 TGGAGCCTGAAGGGCCAGACCGG 0: 1
1: 0
2: 3
3: 82
4: 410
992813051_992813067 25 Left 992813051 5:80408312-80408334 CCCGGAGCTGGCCGGGGAACCCT 0: 1
1: 0
2: 0
3: 16
4: 173
Right 992813067 5:80408360-80408382 TGGAGCCTGAAGGGCCAGACCGG 0: 1
1: 0
2: 3
3: 82
4: 410
992813056_992813067 5 Left 992813056 5:80408332-80408354 CCTGGCCCTCCAATCTGATGTCC 0: 1
1: 0
2: 1
3: 10
4: 204
Right 992813067 5:80408360-80408382 TGGAGCCTGAAGGGCCAGACCGG 0: 1
1: 0
2: 3
3: 82
4: 410
992813057_992813067 0 Left 992813057 5:80408337-80408359 CCCTCCAATCTGATGTCCCCTCC 0: 1
1: 0
2: 1
3: 21
4: 255
Right 992813067 5:80408360-80408382 TGGAGCCTGAAGGGCCAGACCGG 0: 1
1: 0
2: 3
3: 82
4: 410
992813058_992813067 -1 Left 992813058 5:80408338-80408360 CCTCCAATCTGATGTCCCCTCCT 0: 1
1: 0
2: 3
3: 20
4: 251
Right 992813067 5:80408360-80408382 TGGAGCCTGAAGGGCCAGACCGG 0: 1
1: 0
2: 3
3: 82
4: 410
992813055_992813067 6 Left 992813055 5:80408331-80408353 CCCTGGCCCTCCAATCTGATGTC 0: 1
1: 0
2: 0
3: 25
4: 242
Right 992813067 5:80408360-80408382 TGGAGCCTGAAGGGCCAGACCGG 0: 1
1: 0
2: 3
3: 82
4: 410
992813052_992813067 24 Left 992813052 5:80408313-80408335 CCGGAGCTGGCCGGGGAACCCTG 0: 1
1: 0
2: 5
3: 14
4: 193
Right 992813067 5:80408360-80408382 TGGAGCCTGAAGGGCCAGACCGG 0: 1
1: 0
2: 3
3: 82
4: 410
992813060_992813067 -4 Left 992813060 5:80408341-80408363 CCAATCTGATGTCCCCTCCTGGA 0: 1
1: 0
2: 1
3: 18
4: 331
Right 992813067 5:80408360-80408382 TGGAGCCTGAAGGGCCAGACCGG 0: 1
1: 0
2: 3
3: 82
4: 410
992813054_992813067 14 Left 992813054 5:80408323-80408345 CCGGGGAACCCTGGCCCTCCAAT 0: 1
1: 0
2: 0
3: 17
4: 167
Right 992813067 5:80408360-80408382 TGGAGCCTGAAGGGCCAGACCGG 0: 1
1: 0
2: 3
3: 82
4: 410
992813050_992813067 26 Left 992813050 5:80408311-80408333 CCCCGGAGCTGGCCGGGGAACCC 0: 1
1: 0
2: 1
3: 12
4: 161
Right 992813067 5:80408360-80408382 TGGAGCCTGAAGGGCCAGACCGG 0: 1
1: 0
2: 3
3: 82
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992813067 Original CRISPR TGGAGCCTGAAGGGCCAGAC CGG Intronic