ID: 992813069

View in Genome Browser
Species Human (GRCh38)
Location 5:80408365-80408387
Sequence CCTGAAGGGCCAGACCGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 101}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992813052_992813069 29 Left 992813052 5:80408313-80408335 CCGGAGCTGGCCGGGGAACCCTG 0: 1
1: 0
2: 5
3: 14
4: 193
Right 992813069 5:80408365-80408387 CCTGAAGGGCCAGACCGGACTGG 0: 1
1: 0
2: 1
3: 11
4: 101
992813058_992813069 4 Left 992813058 5:80408338-80408360 CCTCCAATCTGATGTCCCCTCCT 0: 1
1: 0
2: 3
3: 20
4: 251
Right 992813069 5:80408365-80408387 CCTGAAGGGCCAGACCGGACTGG 0: 1
1: 0
2: 1
3: 11
4: 101
992813055_992813069 11 Left 992813055 5:80408331-80408353 CCCTGGCCCTCCAATCTGATGTC 0: 1
1: 0
2: 0
3: 25
4: 242
Right 992813069 5:80408365-80408387 CCTGAAGGGCCAGACCGGACTGG 0: 1
1: 0
2: 1
3: 11
4: 101
992813060_992813069 1 Left 992813060 5:80408341-80408363 CCAATCTGATGTCCCCTCCTGGA 0: 1
1: 0
2: 1
3: 18
4: 331
Right 992813069 5:80408365-80408387 CCTGAAGGGCCAGACCGGACTGG 0: 1
1: 0
2: 1
3: 11
4: 101
992813056_992813069 10 Left 992813056 5:80408332-80408354 CCTGGCCCTCCAATCTGATGTCC 0: 1
1: 0
2: 1
3: 10
4: 204
Right 992813069 5:80408365-80408387 CCTGAAGGGCCAGACCGGACTGG 0: 1
1: 0
2: 1
3: 11
4: 101
992813051_992813069 30 Left 992813051 5:80408312-80408334 CCCGGAGCTGGCCGGGGAACCCT 0: 1
1: 0
2: 0
3: 16
4: 173
Right 992813069 5:80408365-80408387 CCTGAAGGGCCAGACCGGACTGG 0: 1
1: 0
2: 1
3: 11
4: 101
992813054_992813069 19 Left 992813054 5:80408323-80408345 CCGGGGAACCCTGGCCCTCCAAT 0: 1
1: 0
2: 0
3: 17
4: 167
Right 992813069 5:80408365-80408387 CCTGAAGGGCCAGACCGGACTGG 0: 1
1: 0
2: 1
3: 11
4: 101
992813057_992813069 5 Left 992813057 5:80408337-80408359 CCCTCCAATCTGATGTCCCCTCC 0: 1
1: 0
2: 1
3: 21
4: 255
Right 992813069 5:80408365-80408387 CCTGAAGGGCCAGACCGGACTGG 0: 1
1: 0
2: 1
3: 11
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992813069 Original CRISPR CCTGAAGGGCCAGACCGGAC TGG Intronic