ID: 992813070

View in Genome Browser
Species Human (GRCh38)
Location 5:80408370-80408392
Sequence AGGGCCAGACCGGACTGGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 119}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992813056_992813070 15 Left 992813056 5:80408332-80408354 CCTGGCCCTCCAATCTGATGTCC 0: 1
1: 0
2: 1
3: 10
4: 204
Right 992813070 5:80408370-80408392 AGGGCCAGACCGGACTGGACCGG 0: 1
1: 0
2: 2
3: 11
4: 119
992813060_992813070 6 Left 992813060 5:80408341-80408363 CCAATCTGATGTCCCCTCCTGGA 0: 1
1: 0
2: 1
3: 18
4: 331
Right 992813070 5:80408370-80408392 AGGGCCAGACCGGACTGGACCGG 0: 1
1: 0
2: 2
3: 11
4: 119
992813057_992813070 10 Left 992813057 5:80408337-80408359 CCCTCCAATCTGATGTCCCCTCC 0: 1
1: 0
2: 1
3: 21
4: 255
Right 992813070 5:80408370-80408392 AGGGCCAGACCGGACTGGACCGG 0: 1
1: 0
2: 2
3: 11
4: 119
992813055_992813070 16 Left 992813055 5:80408331-80408353 CCCTGGCCCTCCAATCTGATGTC 0: 1
1: 0
2: 0
3: 25
4: 242
Right 992813070 5:80408370-80408392 AGGGCCAGACCGGACTGGACCGG 0: 1
1: 0
2: 2
3: 11
4: 119
992813058_992813070 9 Left 992813058 5:80408338-80408360 CCTCCAATCTGATGTCCCCTCCT 0: 1
1: 0
2: 3
3: 20
4: 251
Right 992813070 5:80408370-80408392 AGGGCCAGACCGGACTGGACCGG 0: 1
1: 0
2: 2
3: 11
4: 119
992813064_992813070 -7 Left 992813064 5:80408354-80408376 CCCTCCTGGAGCCTGAAGGGCCA 0: 1
1: 0
2: 0
3: 25
4: 297
Right 992813070 5:80408370-80408392 AGGGCCAGACCGGACTGGACCGG 0: 1
1: 0
2: 2
3: 11
4: 119
992813054_992813070 24 Left 992813054 5:80408323-80408345 CCGGGGAACCCTGGCCCTCCAAT 0: 1
1: 0
2: 0
3: 17
4: 167
Right 992813070 5:80408370-80408392 AGGGCCAGACCGGACTGGACCGG 0: 1
1: 0
2: 2
3: 11
4: 119
992813065_992813070 -8 Left 992813065 5:80408355-80408377 CCTCCTGGAGCCTGAAGGGCCAG No data
Right 992813070 5:80408370-80408392 AGGGCCAGACCGGACTGGACCGG 0: 1
1: 0
2: 2
3: 11
4: 119
992813063_992813070 -6 Left 992813063 5:80408353-80408375 CCCCTCCTGGAGCCTGAAGGGCC 0: 1
1: 1
2: 2
3: 34
4: 249
Right 992813070 5:80408370-80408392 AGGGCCAGACCGGACTGGACCGG 0: 1
1: 0
2: 2
3: 11
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992813070 Original CRISPR AGGGCCAGACCGGACTGGAC CGG Intronic