ID: 992813076

View in Genome Browser
Species Human (GRCh38)
Location 5:80408384-80408406
Sequence CTGGACCGGGAGGGCAATCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992813056_992813076 29 Left 992813056 5:80408332-80408354 CCTGGCCCTCCAATCTGATGTCC 0: 1
1: 0
2: 1
3: 10
4: 204
Right 992813076 5:80408384-80408406 CTGGACCGGGAGGGCAATCACGG No data
992813063_992813076 8 Left 992813063 5:80408353-80408375 CCCCTCCTGGAGCCTGAAGGGCC 0: 1
1: 1
2: 2
3: 34
4: 249
Right 992813076 5:80408384-80408406 CTGGACCGGGAGGGCAATCACGG No data
992813060_992813076 20 Left 992813060 5:80408341-80408363 CCAATCTGATGTCCCCTCCTGGA 0: 1
1: 0
2: 1
3: 18
4: 331
Right 992813076 5:80408384-80408406 CTGGACCGGGAGGGCAATCACGG No data
992813058_992813076 23 Left 992813058 5:80408338-80408360 CCTCCAATCTGATGTCCCCTCCT 0: 1
1: 0
2: 3
3: 20
4: 251
Right 992813076 5:80408384-80408406 CTGGACCGGGAGGGCAATCACGG No data
992813068_992813076 -4 Left 992813068 5:80408365-80408387 CCTGAAGGGCCAGACCGGACTGG 0: 1
1: 0
2: 0
3: 19
4: 383
Right 992813076 5:80408384-80408406 CTGGACCGGGAGGGCAATCACGG No data
992813057_992813076 24 Left 992813057 5:80408337-80408359 CCCTCCAATCTGATGTCCCCTCC 0: 1
1: 0
2: 1
3: 21
4: 255
Right 992813076 5:80408384-80408406 CTGGACCGGGAGGGCAATCACGG No data
992813066_992813076 3 Left 992813066 5:80408358-80408380 CCTGGAGCCTGAAGGGCCAGACC 0: 1
1: 0
2: 1
3: 30
4: 239
Right 992813076 5:80408384-80408406 CTGGACCGGGAGGGCAATCACGG No data
992813064_992813076 7 Left 992813064 5:80408354-80408376 CCCTCCTGGAGCCTGAAGGGCCA 0: 1
1: 0
2: 0
3: 25
4: 297
Right 992813076 5:80408384-80408406 CTGGACCGGGAGGGCAATCACGG No data
992813055_992813076 30 Left 992813055 5:80408331-80408353 CCCTGGCCCTCCAATCTGATGTC 0: 1
1: 0
2: 0
3: 25
4: 242
Right 992813076 5:80408384-80408406 CTGGACCGGGAGGGCAATCACGG No data
992813065_992813076 6 Left 992813065 5:80408355-80408377 CCTCCTGGAGCCTGAAGGGCCAG No data
Right 992813076 5:80408384-80408406 CTGGACCGGGAGGGCAATCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992813076 Original CRISPR CTGGACCGGGAGGGCAATCA CGG Intronic