ID: 992813077

View in Genome Browser
Species Human (GRCh38)
Location 5:80408387-80408409
Sequence GACCGGGAGGGCAATCACGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 42}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992813063_992813077 11 Left 992813063 5:80408353-80408375 CCCCTCCTGGAGCCTGAAGGGCC 0: 1
1: 1
2: 2
3: 34
4: 249
Right 992813077 5:80408387-80408409 GACCGGGAGGGCAATCACGGCGG 0: 1
1: 0
2: 0
3: 0
4: 42
992813066_992813077 6 Left 992813066 5:80408358-80408380 CCTGGAGCCTGAAGGGCCAGACC 0: 1
1: 0
2: 1
3: 30
4: 239
Right 992813077 5:80408387-80408409 GACCGGGAGGGCAATCACGGCGG 0: 1
1: 0
2: 0
3: 0
4: 42
992813072_992813077 -10 Left 992813072 5:80408374-80408396 CCAGACCGGACTGGACCGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 74
Right 992813077 5:80408387-80408409 GACCGGGAGGGCAATCACGGCGG 0: 1
1: 0
2: 0
3: 0
4: 42
992813064_992813077 10 Left 992813064 5:80408354-80408376 CCCTCCTGGAGCCTGAAGGGCCA 0: 1
1: 0
2: 0
3: 25
4: 297
Right 992813077 5:80408387-80408409 GACCGGGAGGGCAATCACGGCGG 0: 1
1: 0
2: 0
3: 0
4: 42
992813058_992813077 26 Left 992813058 5:80408338-80408360 CCTCCAATCTGATGTCCCCTCCT 0: 1
1: 0
2: 3
3: 20
4: 251
Right 992813077 5:80408387-80408409 GACCGGGAGGGCAATCACGGCGG 0: 1
1: 0
2: 0
3: 0
4: 42
992813057_992813077 27 Left 992813057 5:80408337-80408359 CCCTCCAATCTGATGTCCCCTCC 0: 1
1: 0
2: 1
3: 21
4: 255
Right 992813077 5:80408387-80408409 GACCGGGAGGGCAATCACGGCGG 0: 1
1: 0
2: 0
3: 0
4: 42
992813060_992813077 23 Left 992813060 5:80408341-80408363 CCAATCTGATGTCCCCTCCTGGA 0: 1
1: 0
2: 1
3: 18
4: 331
Right 992813077 5:80408387-80408409 GACCGGGAGGGCAATCACGGCGG 0: 1
1: 0
2: 0
3: 0
4: 42
992813068_992813077 -1 Left 992813068 5:80408365-80408387 CCTGAAGGGCCAGACCGGACTGG 0: 1
1: 0
2: 0
3: 19
4: 383
Right 992813077 5:80408387-80408409 GACCGGGAGGGCAATCACGGCGG 0: 1
1: 0
2: 0
3: 0
4: 42
992813065_992813077 9 Left 992813065 5:80408355-80408377 CCTCCTGGAGCCTGAAGGGCCAG No data
Right 992813077 5:80408387-80408409 GACCGGGAGGGCAATCACGGCGG 0: 1
1: 0
2: 0
3: 0
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992813077 Original CRISPR GACCGGGAGGGCAATCACGG CGG Intronic