ID: 992818325

View in Genome Browser
Species Human (GRCh38)
Location 5:80467403-80467425
Sequence CTGCCTGACTTGAATGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992818323_992818325 -5 Left 992818323 5:80467385-80467407 CCAAGATAGAGGTGTCCACTGCC 0: 1
1: 1
2: 0
3: 10
4: 104
Right 992818325 5:80467403-80467425 CTGCCTGACTTGAATGTTGAAGG 0: 1
1: 0
2: 0
3: 12
4: 167
992818321_992818325 20 Left 992818321 5:80467360-80467382 CCTCTGCACAAGCAGGAAGTGAT 0: 1
1: 0
2: 0
3: 16
4: 157
Right 992818325 5:80467403-80467425 CTGCCTGACTTGAATGTTGAAGG 0: 1
1: 0
2: 0
3: 12
4: 167
992818319_992818325 27 Left 992818319 5:80467353-80467375 CCTTGAGCCTCTGCACAAGCAGG 0: 1
1: 6
2: 24
3: 78
4: 317
Right 992818325 5:80467403-80467425 CTGCCTGACTTGAATGTTGAAGG 0: 1
1: 0
2: 0
3: 12
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992818325 Original CRISPR CTGCCTGACTTGAATGTTGA AGG Intronic
902961772 1:19968675-19968697 CTGAAGGACTTGAATGTAGAAGG - Intergenic
903367324 1:22813153-22813175 CTGCCTGACTGGCAAGTTGAAGG - Intronic
903542219 1:24102966-24102988 CTGCCTGATGTGATTGATGATGG + Intronic
904626712 1:31810218-31810240 CTGCATAACTTGACTGTTCACGG - Intronic
909854576 1:80512211-80512233 CTGCAGGACTTGAATATTCATGG + Intergenic
911751899 1:101505117-101505139 CTGACAGACTTGAGTTTTGAGGG - Intergenic
913059529 1:115192376-115192398 CTGCATAACTTGAAGGTTGGAGG - Intergenic
915166693 1:153951960-153951982 CTGCCTGACTGGAGGGATGAAGG - Intronic
920115166 1:203615635-203615657 ATGCCTGCCTAGAATGTGGAGGG + Intergenic
921907514 1:220510713-220510735 CTCCCTGGCTTGAGCGTTGAGGG - Intergenic
923680069 1:236111894-236111916 CTGGCTGTTTTCAATGTTGATGG - Intergenic
1063189091 10:3677427-3677449 TTACTTGACTTGAATGTTGGTGG - Intergenic
1068501133 10:57840813-57840835 CTGACAGACTTGAACTTTGAGGG - Intergenic
1069214758 10:65805159-65805181 ATGTGTGACTTTAATGTTGAGGG + Intergenic
1069554523 10:69389133-69389155 ATGCCTGGCTTGAATGCTGCCGG - Intronic
1069775433 10:70924468-70924490 CTGCCTGGGTTGAAGGTGGATGG - Intergenic
1072360330 10:94653059-94653081 CTCCCTGACTGGTAGGTTGAGGG + Intergenic
1077677562 11:4209853-4209875 CTGCCTGATTTGTATGATGGTGG + Intergenic
1078031799 11:7759836-7759858 TTGGCAGACTTGAATTTTGAAGG + Intergenic
1081712210 11:45224627-45224649 CTGTCGGCCTTGAATGATGAAGG - Exonic
1084352715 11:68614834-68614856 CTGCCTGACTTGAATGGCGTTGG + Exonic
1085331869 11:75658879-75658901 CTGCCTGATTTGAGGGTTGTTGG - Intronic
1085955520 11:81388950-81388972 CTGCGGAACTTGAATGTAGATGG + Intergenic
1086426113 11:86683953-86683975 CTGCATTACTAGAATTTTGATGG - Intergenic
1087943763 11:104133536-104133558 CTGCCATACTTGAATATGGAGGG - Intronic
1092678056 12:10944356-10944378 CTTCCTGATTTGATTGTTGTTGG + Intronic
1092901414 12:13062913-13062935 CTGCCAGACTTGGATGAAGACGG + Exonic
1093195821 12:16128663-16128685 CTGACAGACATGAATGTTGGAGG - Intergenic
1093964407 12:25309851-25309873 CTCCCTGACTTGTAGGGTGAAGG + Intergenic
1095416624 12:41984025-41984047 CTGCCTGGCTTGATTTATGAAGG + Intergenic
1096688283 12:53303552-53303574 CTGGCTGCCCTGAAGGTTGAGGG + Intronic
1097171483 12:57116579-57116601 CAGCCTGAAATGAATCTTGAAGG + Intronic
1097564786 12:61253542-61253564 CTGCCTGACTGGTAGGGTGAGGG - Intergenic
1097859837 12:64507882-64507904 CTGCCTGACTGGAATATGCAAGG + Intergenic
1104768046 12:131343249-131343271 CTGACAGACTTGAACTTTGAGGG + Intergenic
1105762966 13:23530624-23530646 CTGACAGACTTGAGTTTTGAGGG - Intergenic
1108185146 13:47881142-47881164 CTGGCTGAAATCAATGTTGAAGG - Intergenic
1108256385 13:48615625-48615647 TTGCCAGAACTGAATGTTGAAGG + Intergenic
1109752315 13:66710813-66710835 TTGCTGGATTTGAATGTTGAGGG - Intronic
1110208274 13:72943811-72943833 CTGCCTAACTTGAAAGTTCTTGG - Intronic
1110645219 13:77875277-77875299 CTGCCTAACTTATATGTTGTTGG - Intergenic
1112196068 13:97227675-97227697 CTAATTGACTTGAATTTTGAAGG + Intronic
1112519626 13:100084066-100084088 CTGACTGACTTGAGCTTTGAGGG - Intergenic
1112688653 13:101863364-101863386 CTGCCTGCAATGGATGTTGATGG + Intronic
1116813015 14:49557244-49557266 CTGTCTGACTTCAAAGTTCAAGG - Intergenic
1116973201 14:51089869-51089891 CTGTTTGACATGAATGTTTATGG + Intronic
1117008286 14:51444628-51444650 CTGTCTGCCTTGAATGGTGATGG + Intergenic
1118108491 14:62688932-62688954 TTGCCTTAGTTCAATGTTGAAGG - Intergenic
1119882984 14:78116224-78116246 CTGCCTAATTTGAAGGTGGAGGG - Intergenic
1120949606 14:90029058-90029080 CTGCCTGCCTTAAATTTTCAAGG + Intronic
1121748350 14:96321622-96321644 CTGCCTGGCATAAATATTGAGGG + Intronic
1125816357 15:42588375-42588397 TTGCCTGATTTGAAATTTGATGG + Intronic
1126340390 15:47634897-47634919 ATGTCTGACTGGAATGTGGAAGG + Intronic
1127069045 15:55270371-55270393 ATGCCTGTTTTGAAAGTTGATGG - Exonic
1127810439 15:62560764-62560786 CTGCCTGAATTGCATAATGAAGG + Intronic
1128726752 15:69993696-69993718 ATGCTTGACTTGAGTGTGGAAGG - Intergenic
1129615110 15:77092578-77092600 CTTCTTGAATTGAATGTTCAGGG + Intergenic
1131113857 15:89782093-89782115 CTGCTGGACTTGAGTGCTGAGGG + Intergenic
1132767437 16:1541592-1541614 CTGCCTGACTTGACCCTTGAAGG - Intronic
1133554224 16:6889538-6889560 CACCCTGTCTTGAATGATGATGG + Intronic
1133972115 16:10575664-10575686 CTTCCTCACTTTAATCTTGATGG - Intronic
1134358379 16:13506123-13506145 CAGAATGACTTGAATGTTCAAGG - Intergenic
1136050337 16:27645727-27645749 CTTCCTGACCGGAATGTGGATGG - Intronic
1138517110 16:57542243-57542265 CTGCCTGACCTGACAATTGATGG - Intergenic
1143381846 17:6501543-6501565 CTGGCTGATTTGCATGTCGAGGG - Intronic
1143503155 17:7350492-7350514 ATGCCTGACAGCAATGTTGATGG - Intronic
1146649285 17:34596909-34596931 CTGCCTGACCGGAATCTCGATGG + Intronic
1148573048 17:48685934-48685956 AAGCCTGACTTGAATTATGAAGG + Intergenic
1152226666 17:79095965-79095987 AGGCCTGACTTGGATGCTGAGGG + Intronic
1154044468 18:10891378-10891400 CTGCCTTACTTGTTTGATGATGG - Intronic
1155451047 18:25963116-25963138 CTGCCTGACCTGGGTTTTGAAGG - Intergenic
1158314026 18:56190698-56190720 CTGCCTGAGTTGAATGGTATGGG - Intergenic
1165746901 19:38234901-38234923 CTCCCTGCCATGAAGGTTGAGGG - Intergenic
1166091114 19:40509771-40509793 CTGTCTGGCTTGCAGGTTGATGG + Intronic
1166277550 19:41765100-41765122 CTACCTGACTTTAAGGTTAATGG - Intronic
1166405079 19:42514618-42514640 CAGCCTGAGTTGACTGGTGAGGG - Intronic
1166414526 19:42584277-42584299 CAGCCTGAGTTGACTGGTGAGGG - Intronic
1168362898 19:55757499-55757521 CTCGCTGACTGGGATGTTGAAGG + Intergenic
1168363856 19:55767501-55767523 CTCGCTGACTGGGATGTTGAAGG + Intergenic
927306859 2:21583542-21583564 CTACCTGACTTGAATCTACAAGG - Intergenic
928470981 2:31575540-31575562 ATGCCTGACCTGAATCTTGAAGG + Intronic
930145981 2:48004717-48004739 CTTCCTGCCTGGAGTGTTGAGGG - Intergenic
930370612 2:50496507-50496529 CTATCTGACCTGGATGTTGAAGG - Intronic
930647831 2:53930602-53930624 CGGCCTAACTTGAATATTTATGG + Intronic
930735401 2:54773497-54773519 CTTCCTTTCTTGAATGATGAGGG - Intronic
931658666 2:64535696-64535718 ATGCCTGAATAGAATTTTGAAGG + Intronic
932969472 2:76522483-76522505 CTGCCTGAACTGAATAGTGAGGG + Intergenic
937647583 2:124283240-124283262 CTGCCTGCCAAAAATGTTGAGGG - Intronic
943006764 2:182394786-182394808 CTCCCTGACTTGTAGGGTGAGGG + Intronic
944668087 2:201973124-201973146 CTGGCTGCCCTGAATGCTGACGG - Intergenic
944987618 2:205195481-205195503 CTCCCTGACTTGACTGTTCTGGG - Intronic
945757737 2:213869930-213869952 AGGCCTGGTTTGAATGTTGATGG + Intronic
946097402 2:217287323-217287345 GTGTGTCACTTGAATGTTGAAGG + Intronic
947370401 2:229439959-229439981 CTGAATGATTTGAATTTTGAGGG + Intronic
1170670293 20:18426614-18426636 CAGCCTATTTTGAATGTTGAAGG - Intronic
1172442518 20:34976235-34976257 TTGCCTGTTTTGAATGTAGATGG + Intronic
1175327716 20:58141340-58141362 CTGACTGCCTTGTATGTTGTGGG - Intergenic
1178056103 21:28799978-28800000 CTGCCAGACTTGAGTGTTCTTGG - Intergenic
1182769405 22:32783192-32783214 ATGCCTGACTTGGAAGTTCATGG + Intronic
1182844872 22:33422141-33422163 CTGCCTGCTTTGAAAGTCGAAGG - Intronic
1183370424 22:37428632-37428654 CTGCCTGAGCTGAATCTTGATGG + Intergenic
1183786821 22:40034091-40034113 TGGCCTGACTTGAGTGTGGAAGG - Exonic
1184966288 22:47974592-47974614 CTGCTGGACTTGCCTGTTGAGGG + Intergenic
949313283 3:2724162-2724184 CTGCCTAAGTTGAATGATTATGG + Intronic
949488563 3:4565182-4565204 CAGCCTCACTTGACAGTTGAGGG + Intronic
951115496 3:18856525-18856547 CTTCCTGAAATGAATGTTAACGG - Intergenic
956919127 3:73907631-73907653 TTACCTTACTTGAATGCTGATGG + Intergenic
957773861 3:84729873-84729895 CTTCCTGTCTTGAATGTAGAGGG - Intergenic
959089610 3:101888152-101888174 TTTCCTGACTTGAAATTTGAAGG + Intergenic
959602180 3:108199870-108199892 CTACCTGACTCAAATGTTCAAGG - Intronic
961600173 3:128054336-128054358 CTGTCTGAAATGAATCTTGATGG - Intronic
963722725 3:148881588-148881610 CTTCCTGTGTTCAATGTTGATGG + Exonic
966719913 3:183052296-183052318 CTGACTGAATTGAATTTTAATGG - Intronic
966818522 3:183907880-183907902 CCGGCTGCCTTGGATGTTGATGG + Intergenic
967323054 3:188212889-188212911 CTGGCTCACTTGCATGGTGATGG + Intronic
970305637 4:14729079-14729101 CTGCCTGCTTTTAATCTTGATGG - Intergenic
970848238 4:20569448-20569470 CTTCCTGACTTTTATTTTGAGGG - Intronic
973638088 4:52878048-52878070 ATGCCTGAGCTGATTGTTGAAGG - Intronic
973716120 4:53678194-53678216 CTTTCTGACTGGAATGTGGATGG + Intronic
974459041 4:62164134-62164156 CTCCCTGACTTGTAGGGTGAGGG + Intergenic
974838404 4:67276526-67276548 CTGACAGACTTGAACTTTGAGGG + Intergenic
977430624 4:96927118-96927140 CTCCCTGACTGGTATGGTGAGGG + Intergenic
978112243 4:104977140-104977162 CTGCCTCACTTGTTTGTGGAAGG - Intergenic
979277122 4:118827025-118827047 CTGCTTGAGCTGAATCTTGAAGG + Intronic
980498064 4:133609919-133609941 GTGCATGACTTGAAGTTTGAAGG + Intergenic
981809126 4:148753421-148753443 TTGCATGACGTGAAAGTTGATGG - Intergenic
982506533 4:156225612-156225634 CTGCCTGATTTTAATTTTTATGG - Intergenic
986487228 5:8249943-8249965 TTGCTTGACTTAAATGATGAGGG - Intergenic
987578479 5:19759423-19759445 CTCCCTGACTGGTAGGTTGAGGG - Intronic
988169330 5:27633916-27633938 CTCCCTGACTTGTATGGTGACGG - Intergenic
988211637 5:28211941-28211963 CTGCCTAAATTGAAAGTTTACGG + Intergenic
988623373 5:32846171-32846193 ATGCTTGACTTGAATCTTAACGG - Intergenic
989164681 5:38422802-38422824 TTGCCTGTATTGAAAGTTGATGG + Intronic
992188824 5:74270042-74270064 CTTCCTGTCTTCAATGTTGCTGG - Intergenic
992818325 5:80467403-80467425 CTGCCTGACTTGAATGTTGAAGG + Intronic
993323016 5:86498239-86498261 GTGCCTGACTTGCATGATGTAGG - Intergenic
993916796 5:93753958-93753980 CTGTCTGACCTGAATTGTGAGGG - Intronic
996681016 5:126228204-126228226 CTGACAGACTTGAACTTTGAGGG - Intergenic
997063595 5:130537055-130537077 ATGCCTGAGCTGAATCTTGAAGG + Intergenic
997096018 5:130912211-130912233 CTGCCTGTCTTGAATTGGGAAGG - Intergenic
997896752 5:137725525-137725547 CTGCTCAACTTGAATGTTGCTGG - Intronic
1001448565 5:171806667-171806689 CTGCATGAAATGAATCTTGAGGG + Intergenic
1002063764 5:176642132-176642154 CTGCCTGACCTGGATGGTGAGGG - Exonic
1002163067 5:177328253-177328275 CTTCCTGTCTGGAATGTGGAAGG - Intergenic
1002299713 5:178250398-178250420 CTGCCTGACTTCAAAGTTGTTGG + Intronic
1002620830 5:180487046-180487068 CTGCCAGGCTTGAACCTTGAAGG + Intergenic
1004476432 6:15977466-15977488 CCACCTCACTTGCATGTTGATGG + Intergenic
1009051677 6:58283428-58283450 CTGCTTTCCTTGACTGTTGAGGG - Intergenic
1011793687 6:90928752-90928774 CATCCTGCTTTGAATGTTGATGG + Intergenic
1017036098 6:150268723-150268745 CAGCCTCACTGGAATGTTGTGGG - Intergenic
1017353384 6:153471980-153472002 ATGCCTGAAGTGAACGTTGAGGG + Intergenic
1024537699 7:50451453-50451475 CTGCCTGGCTTGGATTGTGAGGG - Intronic
1024549882 7:50553780-50553802 CAGCCTGACTTGTTTCTTGATGG + Intronic
1024958401 7:54950191-54950213 CTCCCTGACTTGTAGGATGAGGG - Intergenic
1026611261 7:71861940-71861962 CTGCCTGTCTTGGATGGTCAAGG - Intronic
1028218627 7:88167050-88167072 CTGTCTGACATGAATTCTGAGGG + Intronic
1031046356 7:116892742-116892764 CTGCCTGCATTGACTGTTAAGGG + Intronic
1032722739 7:134564087-134564109 CTGACGGACTTGAGTTTTGAGGG - Intronic
1034944599 7:155253744-155253766 CTTCCTGACTGGAGTGTGGAAGG + Intergenic
1035529053 8:336966-336988 CTGCCTGCTTTAAATGTTGGAGG + Intergenic
1037040881 8:14231289-14231311 GTGTCTGTCTTGAATGTTGGAGG + Intronic
1039702739 8:39978754-39978776 CTGCTTGGCTGGAATGTTGTAGG - Intronic
1042505979 8:69560955-69560977 TTCCCTGAATTGAATGTTGGTGG + Intronic
1044352711 8:91185295-91185317 CTCCCTGACTAGAATGAGGAAGG + Intronic
1047780101 8:128104307-128104329 CTGCCTGACTACAAAGTTGGTGG + Intergenic
1050989278 9:12127371-12127393 CATCCTGACTTGAATTTCGAGGG + Intergenic
1051130111 9:13851315-13851337 CTCCCAGACTTGAACGTAGAAGG + Intergenic
1052234177 9:26189456-26189478 CTGGATGAGCTGAATGTTGAAGG + Intergenic
1055590358 9:77806307-77806329 CTGCCTGCCTTGAAACTGGATGG + Intronic
1056524883 9:87433599-87433621 ATGTCTCACTTGAATGGTGAGGG - Intergenic
1056684224 9:88746418-88746440 ATGCCTGACTTGTTTGTTGCGGG - Intergenic
1059700482 9:116771106-116771128 ATGTCTGAGTTGAATCTTGAAGG - Intronic
1060947129 9:127576396-127576418 CTGCCTGACTTCAGTGCTGTTGG - Intronic
1061714733 9:132511498-132511520 GTGCCTGCCTGGAATGTTGTAGG + Intronic
1189353866 X:40297064-40297086 CTGTCTGCCTGGAATGATGATGG + Intergenic
1189370371 X:40423224-40423246 CTGCCTAAATTAAATGTTGAAGG + Intergenic
1192896314 X:75446327-75446349 CTGCCTTGGTTTAATGTTGAGGG + Intronic
1194178866 X:90688540-90688562 GTGCAAGAGTTGAATGTTGAGGG - Intergenic
1196236008 X:113280960-113280982 CTCCCTGACTTGAATGAAGAAGG - Intergenic
1197785298 X:130191989-130192011 CTGCCTGACCAGAGTGTTGGGGG - Intergenic