ID: 992824738

View in Genome Browser
Species Human (GRCh38)
Location 5:80537514-80537536
Sequence ATGGATAAAAGTACCTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 1, 2: 10, 3: 31, 4: 210}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992824738_992824741 -4 Left 992824738 5:80537514-80537536 CCCACAAAGGTACTTTTATCCAT 0: 1
1: 1
2: 10
3: 31
4: 210
Right 992824741 5:80537533-80537555 CCATGAGTAGTTGTCAAAATCGG 0: 1
1: 0
2: 2
3: 14
4: 108
992824738_992824744 9 Left 992824738 5:80537514-80537536 CCCACAAAGGTACTTTTATCCAT 0: 1
1: 1
2: 10
3: 31
4: 210
Right 992824744 5:80537546-80537568 TCAAAATCGGTGTTTCAGTGGGG 0: 1
1: 0
2: 1
3: 11
4: 130
992824738_992824743 8 Left 992824738 5:80537514-80537536 CCCACAAAGGTACTTTTATCCAT 0: 1
1: 1
2: 10
3: 31
4: 210
Right 992824743 5:80537545-80537567 GTCAAAATCGGTGTTTCAGTGGG No data
992824738_992824746 19 Left 992824738 5:80537514-80537536 CCCACAAAGGTACTTTTATCCAT 0: 1
1: 1
2: 10
3: 31
4: 210
Right 992824746 5:80537556-80537578 TGTTTCAGTGGGGTAGACAAGGG No data
992824738_992824745 18 Left 992824738 5:80537514-80537536 CCCACAAAGGTACTTTTATCCAT 0: 1
1: 1
2: 10
3: 31
4: 210
Right 992824745 5:80537555-80537577 GTGTTTCAGTGGGGTAGACAAGG No data
992824738_992824742 7 Left 992824738 5:80537514-80537536 CCCACAAAGGTACTTTTATCCAT 0: 1
1: 1
2: 10
3: 31
4: 210
Right 992824742 5:80537544-80537566 TGTCAAAATCGGTGTTTCAGTGG 0: 1
1: 0
2: 0
3: 5
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992824738 Original CRISPR ATGGATAAAAGTACCTTTGT GGG (reversed) Intronic
907878061 1:58514485-58514507 ATGGCTAACAGGAGCTTTGTTGG - Intronic
910707333 1:90143756-90143778 AGAGATTAAAATACCTTTGTGGG - Intergenic
911639892 1:100276764-100276786 AAGTATAAAAGTACCATTTTTGG + Intronic
913281533 1:117189837-117189859 GTGGATACCAGTGCCTTTGTGGG + Intronic
914380714 1:147113481-147113503 ATGAGTAAAAGTACTTCTGTAGG + Intergenic
919651523 1:200154237-200154259 ATGATTAAGAGTACTTTTGTGGG + Intronic
923893196 1:238238609-238238631 ATGGAGGAGTGTACCTTTGTAGG + Intergenic
923936685 1:238768836-238768858 ATGAATAAAAATAGCTTTGGAGG + Intergenic
1063442931 10:6088386-6088408 ATGGATTATAGTAACTTTCTTGG + Intergenic
1063885729 10:10576600-10576622 ATGGGTAAAAGTACAATGGTGGG - Intergenic
1065622736 10:27599932-27599954 ATGGACAAAAGTGCCCTTGTGGG - Intergenic
1067399836 10:45961249-45961271 ATGGAAAACAGTGCCTTTGCTGG - Intergenic
1067868165 10:49930540-49930562 ATGGAAAACAGTGCCTTTGCTGG - Intronic
1068583241 10:58766616-58766638 ATGGACAAGAGTACCTTTGTGGG + Intronic
1068707112 10:60089217-60089239 ATGGAGGAAAGTACTTTTGGAGG - Intronic
1069059634 10:63882128-63882150 ACAGACAAAAGTACCTTTATGGG - Intergenic
1069497184 10:68916053-68916075 ATGGTAAAAAGAAGCTTTGTGGG + Intronic
1071045274 10:81366303-81366325 ATTGACAAGAGTACTTTTGTGGG - Intergenic
1074745511 10:116528459-116528481 ATGGATAAAAATACGTCTGTTGG + Intergenic
1079553468 11:21730209-21730231 ATCAGTAAAAGTGCCTTTGTGGG - Intergenic
1081345134 11:41976077-41976099 ATGGAGACACCTACCTTTGTAGG + Intergenic
1081944380 11:46976567-46976589 AAGGATAAAAGTACCTTAAATGG + Intronic
1083191645 11:61056598-61056620 ATGAAGAAAAGCACCTTTGGGGG - Intergenic
1084292351 11:68182226-68182248 GTGGATAAAAATACCTTACTAGG - Intronic
1086515190 11:87603881-87603903 ACAGATAAAAGTGCCATTGTGGG + Intergenic
1088078512 11:105880897-105880919 ATGTAAAAAAATACTTTTGTTGG - Intronic
1089363802 11:117908895-117908917 ATGGATAAAATGACCTCTGGAGG + Intronic
1090114661 11:123955833-123955855 ATGGATGAGAATATCTTTGTGGG + Intergenic
1090607102 11:128432677-128432699 ATGGATAGAAGTCACTTTGGAGG + Intergenic
1091908259 12:4206807-4206829 ATGGAGAAAATTAAGTTTGTGGG + Intergenic
1093041281 12:14382517-14382539 ATGGAAAAAATAACTTTTGTAGG - Intronic
1093101483 12:15034686-15034708 ATGGCTAAAAGTATTTTTGGAGG - Intergenic
1093874102 12:24328708-24328730 ATGGATAAAACAACTTTTGGAGG + Intergenic
1093879821 12:24391376-24391398 ATGGGTAAAAGTACATGTATAGG + Intergenic
1094021423 12:25918190-25918212 GTAGATAAAAGTACTATTGTTGG + Intergenic
1095881401 12:47141257-47141279 ATGGACAAAAGTGCCTTTGTGGG + Intronic
1096888543 12:54743365-54743387 ATGGATACAAGCACCTTTTCTGG + Intergenic
1097414213 12:59294686-59294708 ATGGGCATAAGTACCTTTGGAGG + Intergenic
1098659516 12:73074982-73075004 ATGGAAAAAAGTCTCTTTGTGGG + Intergenic
1098821248 12:75232545-75232567 ATGGACAAAATTGCCTTTGTGGG - Intergenic
1099231222 12:80027616-80027638 ATGTTCAAAAGTGCCTTTGTGGG - Intergenic
1102399254 12:112614380-112614402 ATGCATATAAGATCCTTTGTGGG + Intronic
1103670335 12:122609422-122609444 AAGGAAAAGAGTACCTTCGTAGG - Exonic
1104733244 12:131120687-131120709 ATGGATAAAAATACATTTGCAGG + Intronic
1105399684 13:20078637-20078659 ATGGATAAAAAATGCTTTGTAGG - Intronic
1105813502 13:24013542-24013564 CAGGAAAAAAGTACCTTTTTAGG - Intronic
1108806892 13:54169384-54169406 ATACATATAATTACCTTTGTTGG + Intergenic
1109472967 13:62834840-62834862 ATGGATCAAAGTTCTTTTTTGGG + Intergenic
1111045831 13:82812242-82812264 ATGGATATAAGAACCTTGCTGGG + Intergenic
1111756800 13:92407327-92407349 ATGGTTAAACATAACTTTGTTGG - Intronic
1112101104 13:96190389-96190411 ATGGATACATGTACTTTTATTGG + Intronic
1113056610 13:106274907-106274929 ATGGAAAAAAGTATCTTTAATGG - Intergenic
1114185847 14:20401602-20401624 ATGGATGAAAGGACCCCTGTGGG - Intronic
1114380279 14:22196309-22196331 ATGGATACAGGTTCCTTTTTGGG + Intergenic
1116063803 14:39957402-39957424 ATGGATAAAAGTAAATATGAAGG - Intergenic
1116229046 14:42192688-42192710 ATGGGCAAAAGTATCTTTGTGGG - Intergenic
1116681974 14:47983842-47983864 ATGGACAAAAGAGCCTTTGTGGG + Intergenic
1116957522 14:50940095-50940117 TTGGATAAAAGTACCTTCTCTGG + Intronic
1117048579 14:51837867-51837889 AGGGATAAAAATATCTTGGTTGG - Intronic
1117807482 14:59509301-59509323 ATGCATAAAGGATCCTTTGTGGG - Intronic
1120282903 14:82462077-82462099 ATGGATAAAAGATCCTTTTGTGG + Intergenic
1123501228 15:20882848-20882870 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1123558480 15:21456553-21456575 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1123594711 15:21893828-21893850 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1124654624 15:31498366-31498388 ATGGATAATGTTACCTGTGTTGG - Intronic
1125451337 15:39810804-39810826 AAGTGTAAAAGTTCCTTTGTAGG - Intronic
1126366095 15:47896131-47896153 ATGAATAAAAGTACATCTGCTGG + Intergenic
1127906103 15:63377315-63377337 ATGGAAAAGCGTACCCTTGTGGG + Intronic
1129424217 15:75452829-75452851 ATGGATAAAATTTCCGTAGTTGG + Intronic
1131606198 15:93905346-93905368 TTGGACAAAAGTACCCTTCTTGG + Intergenic
1131660848 15:94514088-94514110 ATGAATAAAAGTTCCACTGTTGG + Intergenic
1202966830 15_KI270727v1_random:183703-183725 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1134911584 16:18031640-18031662 ATGGATAAGAATCCATTTGTAGG - Intergenic
1135296713 16:21285780-21285802 TTGGGTAAATATACCTTTGTGGG - Intronic
1142602016 17:1058117-1058139 AAAGATAAAAGGAGCTTTGTTGG - Intronic
1143396868 17:6606584-6606606 CTAGAGAAAAGTACCTTTGAGGG + Intronic
1144377401 17:14657860-14657882 TGGAAAAAAAGTACCTTTGTGGG - Intergenic
1146983666 17:37191106-37191128 AAGGAGAAATGTACCTTTGATGG + Exonic
1147517334 17:41133017-41133039 ATGGATAAAAATTGCTTTATAGG + Intergenic
1148022247 17:44561051-44561073 ATGTCTAAAAGTATCTTTGCTGG + Intergenic
1149809127 17:59650386-59650408 TAGGAGAAAAGTACCATTGTAGG + Intronic
1150537348 17:66056756-66056778 ATGGATAAAGGTTTCTTTCTAGG + Intronic
1150606653 17:66697351-66697373 ATGGACAAGAGTGTCTTTGTAGG + Intronic
1158457304 18:57619532-57619554 ATGGTTAAAAGTTCCTTCCTTGG - Intronic
1159178761 18:64874173-64874195 GTGGATAGAAACACCTTTGTGGG + Intergenic
1159294819 18:66471262-66471284 TTGGATAAAAGGACATTTTTGGG - Intergenic
1159624005 18:70670450-70670472 GTGGACAAAAGTGCCTTTGTGGG - Intergenic
1159951070 18:74484141-74484163 ATGCATAAAACTACTTTTGCAGG - Intergenic
1159993549 18:74939974-74939996 ATGGATACAAAAACCTTTCTTGG + Intronic
1163963962 19:20725992-20726014 ATGTATAGAAGTTACTTTGTTGG - Intronic
1164947055 19:32304595-32304617 AAAGATAAGAGTACCTCTGTGGG - Intergenic
1165409116 19:35648012-35648034 ATGAATAAAAGTACTTTCGCTGG + Intergenic
925051770 2:821083-821105 ATGGATGAAGGTACCTGTGCAGG + Intergenic
925408436 2:3624753-3624775 ATGAACAAAAGTGTCTTTGTAGG - Intronic
926352656 2:12010993-12011015 GTTGGTAAAAGTGCCTTTGTAGG + Intergenic
929290167 2:40181447-40181469 AAAGAAAAAAGTACTTTTGTAGG + Intronic
929372445 2:41242224-41242246 ACGAACAAAAGTGCCTTTGTGGG - Intergenic
929721031 2:44367796-44367818 ATCTATCAAAGTACCATTGTGGG + Intronic
931396816 2:61895267-61895289 ACAGATAAAAGTACCTCTGTTGG + Intronic
932903750 2:75728305-75728327 GTGGATAAAAATACTTTTTTTGG + Intergenic
933361487 2:81291931-81291953 AGGGATGAAAATAACTTTGTGGG - Intergenic
933496476 2:83056276-83056298 ATGGAGAAAATTAATTTTGTGGG + Intergenic
933562849 2:83910623-83910645 ATAAATAAAAATACCTTTTTTGG - Intergenic
935464412 2:103379430-103379452 ATGAACAACAGTACCTTTCTGGG - Intergenic
936897511 2:117445270-117445292 ATGGATATGAGTAACTTTTTGGG + Intergenic
939418217 2:141928952-141928974 CCTGATAAAAGTATCTTTGTAGG + Intronic
939667032 2:144964987-144965009 ATGGAGAAAAGGAACTTTTTGGG + Intergenic
939745549 2:145961740-145961762 ATGGACAAGAGTACATTTGTGGG - Intergenic
941988935 2:171535984-171536006 ATGCATAAAAGTACCTAAATCGG + Intronic
942037367 2:172023641-172023663 ATGTTTATAAGTTCCTTTGTTGG - Intronic
942667110 2:178331333-178331355 ATGTATAAAAGAATCTTGGTAGG + Intronic
943856137 2:192794120-192794142 TTAGATAAAAGTACTATTGTAGG - Intergenic
945819523 2:214646766-214646788 ATGAATAATAGTACCTTTTAAGG + Intergenic
946912326 2:224476577-224476599 ATGGATAAATGTACATGTGTAGG - Intronic
1169282806 20:4281307-4281329 AGGAATAAAAGTAAATTTGTTGG + Intergenic
1169511083 20:6264674-6264696 ATAGAAAAAAGTTTCTTTGTTGG + Intergenic
1169721055 20:8676826-8676848 AGGGAAAAAAGTAACTTTGTAGG + Intronic
1169904461 20:10587515-10587537 ATGAAGAAAAGTCCCTTTTTTGG + Intronic
1170074925 20:12409201-12409223 ATAGATCAATGTACCTTTGTAGG + Intergenic
1170855237 20:20047008-20047030 AAGAATAAAAACACCTTTGTTGG - Intronic
1171111355 20:22485427-22485449 ATGAATAAAAATACCCTTCTCGG - Intergenic
1173584666 20:44173595-44173617 ATGGATAAAATTAACTTATTAGG - Intronic
1175614838 20:60389083-60389105 ATGGATACAGGTTTCTTTGTGGG + Intergenic
1176904448 21:14482913-14482935 ATAGTTAAAAAGACCTTTGTTGG + Intergenic
1177390202 21:20459503-20459525 ATGGATAAAAGTGTCTTCGTGGG + Intergenic
1177587646 21:23119133-23119155 ATGTATAAAACTAACTTTGACGG - Intergenic
1177590333 21:23156082-23156104 ATGAAGAAAACTACATTTGTAGG + Intergenic
1178086794 21:29120297-29120319 ATGGCTCAAATTGCCTTTGTAGG - Intronic
1179012760 21:37568824-37568846 ATGGATCAAAGGACATTTATGGG - Intergenic
1179356336 21:40664122-40664144 ATGGATAAGAGGACATTTGCAGG - Intronic
1182786911 22:32915659-32915681 AAGGATGGAAGTACCATTGTGGG + Intronic
1184078171 22:42197261-42197283 AAGGATAAAACTAACTTTGCTGG - Intronic
951733439 3:25836492-25836514 ATGAACAAAACTGCCTTTGTGGG + Intergenic
952086774 3:29832401-29832423 ATGGATGAGAGTACCTTTGTGGG + Intronic
952590733 3:34950880-34950902 ATGGATAGTTGTATCTTTGTGGG - Intergenic
952804487 3:37334934-37334956 ATAGAGAAAACTACCTCTGTAGG - Intronic
953220030 3:40961074-40961096 ATGGACAAATGTGCCTTTGTAGG - Intergenic
954022089 3:47751196-47751218 CTGAATAAAAGTTACTTTGTCGG - Intronic
954493700 3:50931985-50932007 ATGGACAAGAGTACCTTTGTGGG - Intronic
963508537 3:146218911-146218933 GTGGATAAAATTATTTTTGTGGG + Intronic
963703992 3:148663320-148663342 ATGGCTATAAGTTCCTTTGGGGG - Intergenic
964609303 3:158594221-158594243 ATGGAAAAAAGCACCTTTTGAGG + Intronic
965381101 3:167989591-167989613 AGAGATAAAAATACCTTCGTAGG - Intergenic
965710465 3:171551779-171551801 ATTGAGAAAAGTACCTGTGAGGG - Intergenic
966536076 3:181035661-181035683 ATAGATGAGAGTACCTTTGTGGG + Intergenic
966567259 3:181396902-181396924 ATGGAAAAAAGTGCCATTGTGGG - Intergenic
967167385 3:186794086-186794108 CTAGATATAAGTACCTTTTTAGG + Intronic
967453707 3:189655923-189655945 ATGGATAATAGGTCATTTGTGGG - Intronic
970497654 4:16643159-16643181 AGGGATAAAAGTATCTTTGTGGG + Intronic
970625956 4:17882421-17882443 ATGGGTCAAAGTATCCTTGTTGG - Exonic
972512917 4:39786338-39786360 AAGGATAAAAGTGCCTATGTGGG + Intergenic
973689722 4:53414076-53414098 AGGGATAAAATTAACTTTTTTGG + Intronic
973770045 4:54198053-54198075 ATGGATAAAAATGCCATTGGGGG - Intronic
974481185 4:62445744-62445766 ATAGACAAAAGTTCCTTTGTGGG + Intergenic
974652808 4:64777124-64777146 ATGGAGATAACTACCTTTGGCGG - Intergenic
975570046 4:75806283-75806305 ATGGCTAAAAATCCATTTGTAGG - Intronic
976396646 4:84562944-84562966 ATGGATAAAATTAAATTTGGTGG - Intergenic
977045503 4:92064370-92064392 ATGGAAAAAAGTACCTTTCTGGG + Intergenic
978211860 4:106146853-106146875 ATGGAGAGAAGTTCTTTTGTGGG - Intronic
979115163 4:116814537-116814559 ATGGAGAACAGTGCCTGTGTGGG - Intergenic
979147471 4:117263115-117263137 ATGGAGGAAAGGACCTCTGTGGG + Intergenic
979415121 4:120428307-120428329 ATGAATAAAAATATGTTTGTAGG - Intergenic
979801461 4:124914177-124914199 ATAGACAAAATTGCCTTTGTGGG - Intergenic
982778422 4:159465775-159465797 ATAGACAAAAGTTTCTTTGTGGG - Intergenic
983946451 4:173591098-173591120 ATGGAGAAAAATCCCTTTCTGGG - Intergenic
984086501 4:175319128-175319150 GTGGATAATAGGAACTTTGTGGG + Intergenic
984136736 4:175950560-175950582 GTGGAAAAAAGTAGCTTTGGGGG + Intronic
985179874 4:187247558-187247580 ATGGATATATATACATTTGTAGG - Intergenic
989310324 5:40009213-40009235 ATGGATAAAAGTACCATTGTGGG - Intergenic
991155118 5:63425086-63425108 ATGGTTAGAAATATCTTTGTGGG - Intergenic
991307936 5:65201015-65201037 TTGTATAAAAGAACCTTTGATGG - Intronic
992824738 5:80537514-80537536 ATGGATAAAAGTACCTTTGTGGG - Intronic
993194393 5:84722445-84722467 ATGGACAAAAGTGCCTTTGTGGG + Intergenic
994404091 5:99321304-99321326 ATGAAAAAAATTACCTTTATAGG + Intergenic
994793158 5:104258041-104258063 ATGGACAAGAATACCTTTATGGG - Intergenic
995245652 5:109932355-109932377 ATCGTTAAAAGAACCTGTGTAGG - Intergenic
995299933 5:110567670-110567692 AAAGGTAAAAGTTCCTTTGTTGG - Intronic
995336312 5:111003822-111003844 GAGGATCAAAGTACCTTGGTTGG - Intergenic
996636952 5:125703502-125703524 ATAGATTAAAATACCTTTCTTGG + Intergenic
996816016 5:127573290-127573312 ACAGTTAAGAGTACCTTTGTTGG + Intergenic
997554553 5:134784007-134784029 ATGGACAAAAGTTTCTTTTTGGG - Intronic
997964784 5:138348344-138348366 ATGGGTTTAAGTACCTTGGTAGG + Exonic
998890934 5:146744913-146744935 TTTGATAAAAGTATTTTTGTTGG - Intronic
1000090121 5:157922897-157922919 AGAGATAAAAGTACCTCTGAAGG - Intergenic
1000138123 5:158373700-158373722 ATGGAAAAGAGTACATTTATAGG + Intergenic
1000249082 5:159476426-159476448 ATGGATCATACTACCTTTGTGGG - Intergenic
1000455362 5:161442237-161442259 ATTTAAAAAAGTACATTTGTAGG - Intronic
1000670204 5:164052268-164052290 ATGTTAAAAAGTATCTTTGTGGG - Intergenic
1001206131 5:169764791-169764813 ATGAATAAAAGGGCCTTGGTTGG + Intronic
1002676135 5:180914760-180914782 ATGAACAAAAGTATTTTTGTAGG + Intronic
1004301568 6:14463068-14463090 AAGGATAAAAGGAACTATGTGGG - Intergenic
1004601244 6:17152085-17152107 AAGGAAAAAAGTAACGTTGTTGG + Intergenic
1004784871 6:18957078-18957100 CTGAATATAAGTACCTTTGAAGG + Intergenic
1008165099 6:48127686-48127708 ATGGAGAAATGTACCTATATAGG + Intergenic
1008185106 6:48379508-48379530 ATGGCTGTAAGTAACTTTGTTGG - Intergenic
1008781639 6:55113593-55113615 ATGGATAAAATTACTCTTGCAGG - Intronic
1012158893 6:95857448-95857470 ATGGATGAGAGTACCTCTGTGGG - Intergenic
1013723160 6:113056330-113056352 ATGGCTAAAAGTACTATTTTGGG + Intergenic
1014894013 6:126877789-126877811 ATGGACAAGAGTATCCTTGTAGG - Intergenic
1017589658 6:155965179-155965201 ATGGATATAAGTACTTGTATAGG - Intergenic
1017887135 6:158608535-158608557 ATGGATAAATTCACCTTTCTGGG - Intronic
1018151176 6:160940728-160940750 ATGGACAAAAGTGCCTCTGTGGG - Intergenic
1018571218 6:165212012-165212034 ATGGAAAAATGTACATATGTAGG - Intergenic
1024778348 7:52815993-52816015 ATAGACAAAACTGCCTTTGTGGG + Intergenic
1025222163 7:57121315-57121337 AGTGATCAAAATACCTTTGTTGG + Intronic
1025252932 7:57364016-57364038 ATGGACAAAAATTCCTTTGCTGG - Intergenic
1025266842 7:57468539-57468561 AGTGATCAAAATACCTTTGTGGG - Intronic
1025632946 7:63292986-63293008 AGTGATCAAAATACCTTTGTTGG + Intergenic
1025649751 7:63455197-63455219 AGTGATCAAAATACCTTTGTTGG - Intergenic
1025721074 7:64014843-64014865 AGTGATCAAAATACCTTTGTTGG - Intergenic
1026651170 7:72217108-72217130 ATTAAGAAAAGTACCTTTTTGGG + Intronic
1027714187 7:81648921-81648943 ATGGTTAAAACTATCTGTGTGGG + Intergenic
1027973750 7:85121727-85121749 ATGTATATATTTACCTTTGTAGG + Exonic
1028061874 7:86329418-86329440 CTATATAAAAATACCTTTGTGGG - Intergenic
1028284930 7:88984215-88984237 ATGTATAACTGCACCTTTGTAGG + Intronic
1029203214 7:98852965-98852987 ATGGATAAATGAACGTTTGATGG + Intronic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1031538427 7:122963001-122963023 ATGTATAAGAATACCTTTCTAGG + Intergenic
1033493366 7:141867069-141867091 AGGGCTAAAAGTTCATTTGTGGG + Intergenic
1043885008 8:85588855-85588877 AGGGACAAAACTAGCTTTGTGGG - Intergenic
1044509658 8:93059819-93059841 ATGGACAAGAATACTTTTGTAGG + Intergenic
1046685046 8:117215593-117215615 AGGGGTGAAAGTGCCTTTGTTGG - Intergenic
1046696306 8:117343759-117343781 ATGGATGAGAGTACCTTTGTGGG + Intergenic
1048239720 8:132729565-132729587 ATAAAGAAAAGTACATTTGTTGG - Intronic
1050069136 9:1792037-1792059 AGGGATAATAGTACTTGTGTAGG - Intergenic
1050829454 9:9992120-9992142 ATGGGTAAAAGTTTCTTTCTTGG + Intronic
1051963704 9:22800695-22800717 TGGGAAAAAAGTGCCTTTGTAGG + Intergenic
1053520769 9:38776585-38776607 ATGGAACAAATTACCTTTTTTGG + Intergenic
1054192925 9:62000578-62000600 ATGGAACAAATTACCTTTTTTGG + Intergenic
1054645482 9:67588113-67588135 ATGGAACAAATTACCTTTTTTGG - Intergenic
1057433503 9:95017766-95017788 ATGGATACAAGGAACTTTCTGGG - Intronic
1059173829 9:112151294-112151316 ATTTATAAAAGTATCTTTCTTGG + Intronic
1060433604 9:123572683-123572705 TTGGATAAAAGTCCTTTTTTAGG + Intronic
1061875110 9:133539706-133539728 CTGGACAAAAATGCCTTTGTCGG + Intronic
1186750751 X:12619432-12619454 ATGGACAAAAGTGGCTTTGTGGG + Intronic
1189043282 X:37565464-37565486 ATGGTGGATAGTACCTTTGTTGG + Intronic
1190512182 X:51184942-51184964 ATGGACAAAAGTCTCTTTGTGGG + Intergenic
1192195343 X:69024167-69024189 ATGGATAAGATGACCTTTGGAGG - Intergenic
1192332665 X:70190360-70190382 ATGGACCAAAGTACCTTTGTGGG + Intronic
1193632928 X:83911948-83911970 ATGCATAAAAGTGCTTTTGTAGG + Intergenic
1194534847 X:95094022-95094044 ATTGACAAAAGTGTCTTTGTGGG + Intergenic
1195614985 X:106905062-106905084 ATGGATAAACATTTCTTTGTTGG - Intronic
1195793977 X:108622920-108622942 ATGCATTTAAGTGCCTTTGTTGG - Intronic
1196093659 X:111775091-111775113 ATGTATAAATGTAGCTTTCTTGG + Exonic
1196522024 X:116685468-116685490 ATGGATAGAATTACTTTTCTAGG - Intergenic
1196916711 X:120543809-120543831 ATGTAAAAAACTATCTTTGTAGG - Exonic
1197904215 X:131406580-131406602 TTGGATAAAAATACATTGGTGGG - Intergenic
1198195518 X:134356918-134356940 ATTTATAAAATTACCTTTATTGG - Intergenic
1198629413 X:138618133-138618155 AAGTATGAGAGTACCTTTGTGGG + Intergenic
1199261669 X:145781625-145781647 ATGGATGAGAGTACCTTTGCAGG + Intergenic
1199347634 X:146760772-146760794 ATGGACAAAAGTGCCTTTGTAGG + Intergenic
1200290104 X:154863667-154863689 ATGGACAAAAGTGTCTTTGTGGG + Intronic
1200925769 Y:8653273-8653295 AAGAAGAAAAGTATCTTTGTTGG - Intergenic