ID: 992825997

View in Genome Browser
Species Human (GRCh38)
Location 5:80550753-80550775
Sequence AAACACTCCTTGCCCCAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992825997_992826000 3 Left 992825997 5:80550753-80550775 CCCGTCTGGGGCAAGGAGTGTTT No data
Right 992826000 5:80550779-80550801 GACTTCTCCAGGCAGTTGTGTGG No data
992825997_992825999 -8 Left 992825997 5:80550753-80550775 CCCGTCTGGGGCAAGGAGTGTTT No data
Right 992825999 5:80550768-80550790 GAGTGTTTCTTGACTTCTCCAGG No data
992825997_992826001 4 Left 992825997 5:80550753-80550775 CCCGTCTGGGGCAAGGAGTGTTT No data
Right 992826001 5:80550780-80550802 ACTTCTCCAGGCAGTTGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992825997 Original CRISPR AAACACTCCTTGCCCCAGAC GGG (reversed) Intergenic
No off target data available for this crispr