ID: 992827961

View in Genome Browser
Species Human (GRCh38)
Location 5:80568972-80568994
Sequence GTCTCAGGGAACCAAGGTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 231}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992827957_992827961 -10 Left 992827957 5:80568959-80568981 CCTAGTCCTCCAAGTCTCAGGGA 0: 1
1: 1
2: 8
3: 65
4: 309
Right 992827961 5:80568972-80568994 GTCTCAGGGAACCAAGGTGATGG 0: 1
1: 0
2: 1
3: 16
4: 231
992827954_992827961 -6 Left 992827954 5:80568955-80568977 CCAACCTAGTCCTCCAAGTCTCA 0: 1
1: 0
2: 1
3: 16
4: 225
Right 992827961 5:80568972-80568994 GTCTCAGGGAACCAAGGTGATGG 0: 1
1: 0
2: 1
3: 16
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992827961 Original CRISPR GTCTCAGGGAACCAAGGTGA TGG Exonic
900108950 1:997708-997730 GTCTCAGGCTCCCAAGGGGAAGG + Intergenic
901638208 1:10680113-10680135 TTCTCAGGGAACCAATGTGAAGG + Intronic
901839081 1:11942704-11942726 GTGTCAGCGGACCAAGGGGATGG + Intronic
903430666 1:23296410-23296432 ATCTGAAGGAACAAAGGTGAAGG - Intergenic
903885573 1:26539211-26539233 GTCCCCGGGAACCCAGCTGATGG + Intronic
904208502 1:28870717-28870739 CTCTCAGGGACCCAAGAGGAAGG + Intergenic
904934189 1:34115534-34115556 TTCCCAGGTAAACAAGGTGAGGG + Intronic
905365176 1:37447494-37447516 GTGTCAGACAACCCAGGTGATGG - Intergenic
905782163 1:40721524-40721546 GTCTTAGGTATCCAAGGAGATGG + Intronic
906055070 1:42909506-42909528 TTGTCAGGGAACCAATGTGGAGG + Intergenic
906783845 1:48596907-48596929 AGCTCAAGGAACCAAGGGGATGG + Intronic
907299658 1:53478647-53478669 CCCTCAGGAAACCACGGTGATGG - Intergenic
908987883 1:70046769-70046791 GTATCAGGGTACAAAAGTGAAGG - Intronic
909272712 1:73644428-73644450 GTTTGAGGAAACCAAGGTTAAGG + Intergenic
909831929 1:80202755-80202777 GTCTAATGGAACCATGGGGACGG - Intergenic
912542310 1:110426153-110426175 GCCCCAGGGAACCAAGGAAACGG - Intergenic
915322080 1:155061724-155061746 GTCTCAGGGGAGGAAGGTGTAGG - Intronic
915650764 1:157308734-157308756 ATCTCAGGGAACCACTGTGAAGG - Intergenic
915888862 1:159752036-159752058 CACTCAGGCAACCAAGGTCATGG - Intergenic
916026381 1:160837125-160837147 GTCTCAGGGCTCCAATTTGAAGG - Intronic
916281670 1:163058577-163058599 CTTTCAGGGAAGCAAGATGATGG - Intergenic
918751190 1:188271321-188271343 TTTTCAGGGAACGAAGGGGAGGG + Intergenic
920120137 1:203650282-203650304 GTTTCAGGGAGGCCAGGTGAGGG + Intronic
920311192 1:205049241-205049263 GTTTCAGGGAAACAAGGCAAGGG + Intronic
922705275 1:227787261-227787283 GTCTGAGGGAACCAGGGTGTGGG + Intergenic
924037618 1:239953261-239953283 GTTTCAGGGAACAAAGGAGCAGG + Intergenic
924847291 1:247786320-247786342 GAGTCAGGGATCCAAGGTGGGGG + Intergenic
1063240939 10:4168596-4168618 GTCTCATGGAACCAAGGAATAGG - Intergenic
1063486234 10:6423498-6423520 GACTCAGGGAACCATCCTGATGG - Intergenic
1064577639 10:16762125-16762147 GTACCGGGGAGCCAAGGTGAAGG - Intronic
1065099046 10:22316081-22316103 CTCTCAGGGAACCGAGCTGGTGG + Exonic
1065244525 10:23743915-23743937 GTCTCTGAGAACCCAGGAGAGGG + Intronic
1067178907 10:43970401-43970423 GTCCAAGGGATCCAAGGGGAAGG - Intergenic
1067654802 10:48183326-48183348 GTCTCAGGAAACTAGGGAGAAGG + Intronic
1068708614 10:60106019-60106041 CTCTCATGGACCCAAAGTGAGGG + Exonic
1068787366 10:60990969-60990991 GTGTCAGGGAACAATGGTGGAGG - Intronic
1069454900 10:68546381-68546403 GTCTCAGCCATCCAAAGTGATGG + Intergenic
1069538460 10:69274077-69274099 CTCTCAGGCAGCTAAGGTGATGG + Intronic
1073093639 10:100966790-100966812 GTAGCAGGGATCCTAGGTGAAGG - Intergenic
1073527345 10:104196515-104196537 CTCTCAGGGAGCCAGGCTGATGG - Intronic
1074309839 10:112312691-112312713 GGCTCAGGGAAGGAGGGTGAGGG - Intergenic
1075328451 10:121554153-121554175 GTCTCAGAGATCCAAGGTTGGGG + Intronic
1075624039 10:123948798-123948820 GGCTCAAAGAACTAAGGTGAAGG + Intergenic
1076070209 10:127482876-127482898 CTGTCAGGGAACCCAGGGGAGGG - Intergenic
1078546554 11:12251439-12251461 GCCACAGGGAAATAAGGTGATGG - Intronic
1078906442 11:15692454-15692476 GTTTGAGGGTACCAAAGTGAAGG + Intergenic
1078969647 11:16393079-16393101 GTCTCAGGGAACCAGAGTCACGG - Intronic
1081244409 11:40746724-40746746 TGCTCAGGGGACCATGGTGATGG - Intronic
1081670037 11:44937629-44937651 GTCAGAGGCAACCAGGGTGAGGG + Intronic
1083600275 11:63943016-63943038 GGCTCAGGGATCAAAGGTGCTGG - Intronic
1087348974 11:97006787-97006809 GTCTGAGGGAACAAAGGGAATGG - Intergenic
1087410896 11:97789259-97789281 CACTCAGGGAACCAATGTGGGGG + Intergenic
1088856541 11:113760006-113760028 ATGTAAGGGAAGCAAGGTGAGGG + Intronic
1090088045 11:123668543-123668565 GTCTCTGGGAAGTGAGGTGATGG + Intergenic
1091327778 11:134704149-134704171 GTCTCTGGGGACCCAGGTTACGG - Intergenic
1091976792 12:4831938-4831960 GTCTCACAGAAACATGGTGAGGG + Intronic
1096244637 12:49977405-49977427 ATCTTAGGGTACCATGGTGATGG - Intronic
1097037630 12:56134166-56134188 GACTCAGGAGAGCAAGGTGAGGG + Exonic
1098444892 12:70556310-70556332 CTCCCAGGGAACCAAGGTTGGGG + Intronic
1098961840 12:76746878-76746900 ACGTCAGGAAACCAAGGTGAGGG - Intergenic
1099122952 12:78715347-78715369 ATCTCAGGGACCACAGGTGAGGG + Intergenic
1100887257 12:99085008-99085030 GTTTCAGGGAAGCAATGTTATGG - Exonic
1101139173 12:101777440-101777462 TTTTCAGGGAACCAAGGCAATGG - Intronic
1103677007 12:122663817-122663839 CACTCAGGTGACCAAGGTGATGG - Intergenic
1105236431 13:18559121-18559143 TTCTCAGGGAACTAAGCTGAAGG + Intergenic
1107293090 13:38879464-38879486 GACTCAGGGATCAAAGGTGGAGG + Intronic
1108226294 13:48293233-48293255 GGGTCAGGGAGCCAATGTGAAGG + Intergenic
1110148807 13:72225444-72225466 TTCTCAAGGAACCCAAGTGATGG + Intergenic
1115593644 14:34888043-34888065 ATCTGAGGGAATCAAAGTGAAGG - Intergenic
1116050135 14:39792259-39792281 GTCTCATAGAAACAAGGTGCTGG + Intergenic
1118390983 14:65295110-65295132 CTCTCAGGGACCCAGGTTGATGG + Intergenic
1118650972 14:67893957-67893979 GCCTCCAGGAACCAAGATGATGG - Intronic
1118731562 14:68670458-68670480 GTCTCATGAATCCAAGGAGAGGG + Intronic
1122791250 14:104185109-104185131 TTCCCAGGGAACCAGGGTGTGGG - Intergenic
1125246272 15:37644778-37644800 GTCTCAGGAAAGCATGGAGAAGG + Intergenic
1126119508 15:45239338-45239360 GTCTCTAGGAATCATGGTGAAGG + Intergenic
1128557636 15:68642469-68642491 GGCTCAGGGAGCCAAAGGGATGG - Intronic
1130808515 15:87352609-87352631 ATCTAAGGGAACCACGTTGAAGG + Intergenic
1131012512 15:89030744-89030766 TTTTCAGGGATCCAGGGTGATGG - Intergenic
1131442489 15:92469491-92469513 GGCTCAGGGACCCAAGAAGAAGG - Intergenic
1131668721 15:94597234-94597256 GTTCAAGGGAAACAAGGTGAAGG + Intergenic
1133441269 16:5822974-5822996 GTCTTAGGGCACCAAGCTGTAGG + Intergenic
1134256630 16:12617698-12617720 GTTTCAGGAAAACAAGGTCAGGG + Intergenic
1134683286 16:16141514-16141536 GTCTCAGGGCACCAGGGGCAGGG - Exonic
1136288577 16:29258395-29258417 GGCTCAGGGAACCTGTGTGAAGG + Intergenic
1136368580 16:29821428-29821450 GCCTCAGGGCTCCAAGGTAACGG + Intronic
1140165825 16:72549725-72549747 ATGTCAGGGCACCAAGGTAAGGG - Intergenic
1140694149 16:77515222-77515244 AGCTAAGAGAACCAAGGTGATGG + Intergenic
1140730585 16:77852362-77852384 GTGTCAGGAAACCCAGCTGAGGG + Intronic
1141324432 16:83042462-83042484 GTCGCAGGAAAACAAGCTGAGGG + Intronic
1141810272 16:86371342-86371364 GGCTCAGGGAGCAAGGGTGAGGG - Intergenic
1142031650 16:87841474-87841496 GTCTCAGGGAACCTTCTTGAAGG - Intronic
1142094292 16:88231301-88231323 GGCTCAGGGAACCTGTGTGAAGG + Intergenic
1144513260 17:15895789-15895811 GTCTTAGGGAAGCAAAGAGAGGG + Intergenic
1145014290 17:19386759-19386781 GTCTCCGGGATCCGAGGAGATGG - Exonic
1145099211 17:20059605-20059627 GTCTCAGGGATCTAAAGTGAAGG - Intronic
1146297611 17:31661926-31661948 GTCTCTGGGAACCAGGGCAATGG + Intergenic
1146593858 17:34153027-34153049 GTCCCAGGGAAGCCAGGTGTGGG - Intronic
1146629302 17:34458516-34458538 GTCTCAGGGAAGGCGGGTGAGGG - Intergenic
1147549642 17:41430673-41430695 GGATCAGGGAACAAAGGGGAGGG - Intergenic
1148763667 17:50023052-50023074 GCCTCAGGGAACCCAGGGAAAGG - Intergenic
1150668389 17:67167567-67167589 GACCCAGGGAACCAAAGAGAAGG - Exonic
1151343062 17:73484279-73484301 GCTTCAGGGAACCAAGGGGCTGG + Intronic
1153014163 18:568419-568441 ATCTCAGGGAGCAAGGGTGAGGG + Intergenic
1153179128 18:2413227-2413249 ATCCCAGGGAAACAAGGGGAAGG + Intergenic
1153841877 18:9015021-9015043 ATCCCAGAGCACCAAGGTGAGGG - Intergenic
1154513110 18:15130799-15130821 TTCTCAGGGAACTAAGCTGAAGG - Intergenic
1155319115 18:24601475-24601497 GACTCAGGGACCCAAGCTGAAGG + Intergenic
1159070391 18:63616588-63616610 CTCTGAGGGAACCCAGGTGCAGG - Intergenic
1161788729 19:6345485-6345507 GTTTCAGGAAAACAAGGGGAGGG - Intergenic
1162738817 19:12762129-12762151 AACTCTGGGCACCAAGGTGAGGG + Intergenic
1162738942 19:12762972-12762994 TGCTCTGGGCACCAAGGTGAGGG - Intergenic
1163534342 19:17868622-17868644 CTCCCAGGGAACCAAGGGGCAGG + Intergenic
1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG + Intronic
1164457176 19:28418504-28418526 GGCTTAGGGAACCAAAATGAGGG + Intergenic
1164730692 19:30501995-30502017 CTGGCAGGGAAACAAGGTGAGGG + Intronic
1165844204 19:38807820-38807842 GTCTCAGGGAACACAGGGTAAGG - Intronic
1165855716 19:38878447-38878469 GTCTCCGGGATCCAGAGTGAGGG - Intergenic
1166290347 19:41859788-41859810 GTGACAGGGAACCTAGGGGAAGG - Intergenic
1166596818 19:44057790-44057812 GTCTCAGGGTACCATGGAGCAGG + Intronic
1167599358 19:50445324-50445346 GTCTCAAGGTACCAAGGTATTGG - Intronic
1168578200 19:57531208-57531230 GCCCCAGGGACCCAAGATGAAGG - Intronic
925295646 2:2774730-2774752 GTCCCAGGGGACCAAGGCAAGGG - Intergenic
926166431 2:10524188-10524210 GTCTCAGGGAAACAGGGCGATGG + Intergenic
926229095 2:10989390-10989412 ATCTCAGGAAACAAAGGAGAAGG - Intergenic
926826633 2:16912577-16912599 AAGTCAGGGAACCAATGTGAGGG - Intergenic
926870785 2:17413697-17413719 GTTTCAGGAAATAAAGGTGAAGG + Intergenic
926973035 2:18485692-18485714 GTCTCAGGGAAACCTGGGGAAGG - Intergenic
928358044 2:30638717-30638739 GGCTCAGGGTACCAAGTAGATGG - Intronic
928947989 2:36789426-36789448 GTCTCAGGGTCCCAAGGAGGTGG + Intronic
931833059 2:66072397-66072419 GTCTCAGGGAGCAGGGGTGAGGG + Intergenic
932596984 2:73100108-73100130 CTCTAAGGGAAGCTAGGTGAGGG - Intronic
934575386 2:95397382-95397404 GTGTAAGGCAACCAAGGTGCAGG + Intergenic
934920737 2:98343245-98343267 TTCTCAGGCAATCAAGATGATGG - Intronic
938502454 2:131837161-131837183 GTCTCATGGCACAAAGGAGAGGG - Intergenic
938513357 2:131975408-131975430 TTCTCAGGGAACTAAGCTGAAGG - Intergenic
939450105 2:142362924-142362946 GTAACAGGGAAAGAAGGTGAGGG - Intergenic
939871185 2:147527593-147527615 GTCTGTGGGAACCATGCTGAGGG + Intergenic
943120299 2:183726692-183726714 GTCTAATAGAACCAAGGTCATGG - Intergenic
945106191 2:206317290-206317312 GTCTCAGGGAAGAAAGTGGAGGG - Intergenic
945679175 2:212892503-212892525 GAGTCAGGGAACTAAGGTAAAGG + Intergenic
1169131243 20:3167306-3167328 TTCCCAGGCATCCAAGGTGAAGG + Intronic
1172105749 20:32516407-32516429 GGCTCAGGAAACAAGGGTGAAGG + Intronic
1173076396 20:39823671-39823693 GTGCCAGGGACCCAAGGTCAAGG + Intergenic
1173565222 20:44033751-44033773 GTCTCACTGAACTAAAGTGAAGG - Intronic
1175946359 20:62560838-62560860 GACTCAGGGACCCAAGATGAAGG - Intronic
1175987782 20:62772484-62772506 GTCACAGGCTACCAAGGTCATGG + Intergenic
1177117442 21:17103657-17103679 GTATCAAGGAACCAAGCTTACGG - Intergenic
1177978098 21:27876477-27876499 TTCTCAGGGAACTAAGCTGAAGG + Intergenic
1181263252 22:21613895-21613917 GTCTCAGGGTTCCAGGGTGAAGG + Intronic
1181294211 22:21822065-21822087 GTCTCAGGGAAGGCAGGGGAGGG + Intronic
1182845915 22:33430806-33430828 GTCCCAGAGAACAAAGGAGAAGG - Intronic
1182947756 22:34340718-34340740 GTCTCAGAGTCCCAAGGGGAAGG - Intergenic
1183752547 22:39729887-39729909 GTCACTGGGAACCAAGATGAGGG - Intergenic
1183773552 22:39947458-39947480 TTCTCAGGGAGCACAGGTGAGGG + Intronic
1183856337 22:40637273-40637295 GACTCAGAGAAACAAGGCGACGG - Intergenic
1184176964 22:42794101-42794123 GCCTCAGGGAACCCAGATGTAGG + Intergenic
1184298823 22:43543112-43543134 GTCACAGGGAGCCAAGGGGAGGG + Intronic
1184609587 22:45594296-45594318 GTCTCAGAGAACCAAGAAGCTGG - Intronic
1184970713 22:48018004-48018026 TTCTTAGGGAACCAAGAGGAAGG - Intergenic
1185142794 22:49112725-49112747 GACTGAGAGGACCAAGGTGAGGG + Intergenic
1185404773 22:50641556-50641578 GCCTCTGGGGACCAGGGTGAGGG + Intergenic
949513482 3:4786481-4786503 GTATCAGGGAACAAAGGTTTTGG + Intronic
951282684 3:20771987-20772009 GTCTCAGGAGACCAGGGAGAGGG + Intergenic
952029821 3:29128232-29128254 GTCTGTGGGAAGCAAGGTCAGGG - Intergenic
952746580 3:36787555-36787577 GCCTCAGGAACCCAAGCTGAGGG - Intergenic
953378864 3:42451628-42451650 GGCTCAGGGATCCCAGATGATGG + Intergenic
954281186 3:49579236-49579258 GTCTCAGGCACCCAAAGTGCTGG + Intronic
955529119 3:59854496-59854518 GTCTTAGGGAATCCAGGTGCTGG + Intronic
956769123 3:72509598-72509620 CTCTCAGTGGATCAAGGTGATGG + Intergenic
956796703 3:72724495-72724517 GTCTCAGGGAAGCCAGGGGGAGG - Intergenic
959334086 3:105042052-105042074 GTCTGAGGGAAACAAGTTGTTGG + Intergenic
962306493 3:134291562-134291584 GTCTCAGAGATCCAGGCTGATGG - Intergenic
962397864 3:135033266-135033288 GTCTCAGAGAACCCAGGCCATGG + Intronic
963906154 3:150774896-150774918 TTCAGAGGGAGCCAAGGTGATGG + Intergenic
965099080 3:164273872-164273894 GTCTCAGGGAGCAAATGTGGAGG - Intergenic
965300147 3:166998247-166998269 GTCAGAGGGGACCAGGGTGATGG - Intergenic
965642476 3:170844689-170844711 CTCTTAGGGACCCAAGCTGATGG + Intronic
965785340 3:172329303-172329325 GTCTCTAAGAACCAAGGTGAAGG + Intronic
967427151 3:189340301-189340323 GTCCCAGGGACCCAGGATGATGG + Intergenic
967607974 3:191470908-191470930 GTCTCAGGGAGGTGAGGTGATGG - Intergenic
968907459 4:3461317-3461339 GTCTCCAAGAACCAAGGGGAAGG - Intergenic
969100929 4:4767811-4767833 GCCTCAGCCAACCAAGGTGCTGG - Intergenic
969509564 4:7610063-7610085 GTCTGGGGGCCCCAAGGTGACGG - Intronic
979193263 4:117889812-117889834 GTCTCAGGAAACAGAAGTGAGGG + Intergenic
981286149 4:143021121-143021143 GTCTCAGAGAACCAAGCTACAGG + Intergenic
981744794 4:148042234-148042256 AACTCAGTGAACAAAGGTGAAGG - Intronic
984622240 4:181966963-181966985 GTGTGAGGGAACGAAGGGGAGGG - Intergenic
988152814 5:27408407-27408429 GACTCCGGGAGCCAAGCTGAAGG + Intergenic
988774712 5:34467347-34467369 TTGTCAGGGAACCAAGGACAAGG + Intergenic
990937682 5:61167626-61167648 GTCTCAGAGAGCCAATGTGCTGG + Intergenic
991247565 5:64524364-64524386 GTGAAAGGGAACTAAGGTGAAGG + Intronic
992074905 5:73183558-73183580 CTCTCAGGGTACAAAGGTGGTGG - Intergenic
992827961 5:80568972-80568994 GTCTCAGGGAACCAAGGTGATGG + Exonic
994114733 5:96049532-96049554 GCCTCAGGGAGGCAGGGTGAGGG + Intergenic
995218299 5:109620088-109620110 GTGTCAGGGAATCAGGGTCAAGG - Intergenic
996206370 5:120742779-120742801 GTCTCATGGAACTAAAGTCAAGG + Intergenic
996491376 5:124101779-124101801 GTCTCAGGAAGTCAAGGGGAGGG - Intergenic
999075702 5:148793291-148793313 GTCTCAAGGAACCACTGTGGGGG + Intergenic
1002397387 5:178968722-178968744 TTCTCAGGGATTCAAGGTAAGGG - Intergenic
1005992315 6:30910978-30911000 TTCTTAGGGACCCAAGGAGATGG - Intronic
1007713634 6:43840251-43840273 GAATTAGGGAACCTAGGTGAAGG + Intergenic
1010394802 6:75378712-75378734 CACTCAGGGACCCAAGCTGATGG - Intronic
1010506692 6:76669139-76669161 GTCACAGGGAACTGAGGAGAAGG + Intergenic
1011403694 6:86993002-86993024 GTCTCTGGGGACCTAGGGGAGGG - Intronic
1013924341 6:115450399-115450421 GTTGCAGTGAACCGAGGTGACGG + Intergenic
1014617647 6:123623568-123623590 GGTTCAGTGAACCAAGCTGAAGG - Intronic
1014758599 6:125329451-125329473 GACTCAGAGGACCAAAGTGATGG + Intergenic
1016886907 6:148967496-148967518 GTCTAATGGGACCAAGGAGATGG - Intronic
1018533623 6:164795085-164795107 GTTTCAGGAAAGCAAAGTGAAGG - Intergenic
1020329420 7:7002590-7002612 GTCTCAGGGAACACAGGTTTGGG + Intergenic
1020332438 7:7033112-7033134 CTCACAGGGAACCTTGGTGAAGG - Intergenic
1022315791 7:29244441-29244463 GTCTTAAGGCAGCAAGGTGAGGG + Intronic
1022534163 7:31085492-31085514 GTCCTGGGGAACCAAGGGGATGG - Intronic
1023915091 7:44582539-44582561 GTCTCGGAGCACCAAGGAGACGG + Intergenic
1024716626 7:52087151-52087173 GTCTCAGGGAATAAAGATCATGG + Intergenic
1024730292 7:52246050-52246072 GTCTCAGATAGCCCAGGTGAAGG - Intergenic
1026863320 7:73807966-73807988 GTCACAGGGACCTAAGGTGTGGG - Intronic
1028898089 7:96064568-96064590 ATCTCAAGGTACCAAAGTGAGGG + Intronic
1029538010 7:101167013-101167035 GACTCTGGAAACCAAGGTCAGGG + Intergenic
1035259493 7:157652594-157652616 GTCTCAGGGACCCCCGGGGAAGG - Intronic
1035581646 8:744106-744128 GTCTGAGAGAACCACGATGATGG - Intergenic
1035717432 8:1764385-1764407 GTCTGAGGGAAGCGAGGTCAGGG - Intronic
1036016717 8:4793489-4793511 GTGTCTGGGAACCAGGGAGATGG - Intronic
1036782605 8:11659760-11659782 TCCTCAGGGAACCAAGGAGCAGG - Intergenic
1041394992 8:57381096-57381118 GCCTGAGGGAGCCAAGCTGAAGG - Intergenic
1044758802 8:95495039-95495061 GTCTCAGTGAACAAATGTAATGG + Intergenic
1049442962 8:142617539-142617561 GCCTCTGGGAACCTAGGTGGTGG - Intergenic
1055707801 9:79026309-79026331 GTCTCAGGCAACCCAGTGGAAGG + Intergenic
1058003256 9:99889174-99889196 GTCACTCAGAACCAAGGTGAAGG - Intergenic
1058345292 9:103953607-103953629 TTCTCAGGCAACCAAGGTCATGG + Intergenic
1058583576 9:106483894-106483916 TTCCCAGGTAAGCAAGGTGAGGG - Intergenic
1058800577 9:108541136-108541158 ATCTCTTGGAACCAAGGCGAGGG - Intergenic
1059628938 9:116098774-116098796 GACTTAGGAAACCAAGTTGATGG + Intergenic
1060234839 9:121855241-121855263 GTCTCATGAACCCAGGGTGATGG + Intronic
1060447050 9:123699520-123699542 GGCACAGGGAGCCAGGGTGAGGG - Intronic
1061062833 9:128259160-128259182 GTTGCAGGAAACCCAGGTGAGGG - Exonic
1061152585 9:128837350-128837372 GTTGCAGGGATCCAATGTGATGG - Intronic
1187226842 X:17381055-17381077 GTCTCAGGGAGGGAACGTGAAGG + Intronic
1187234726 X:17456608-17456630 GACCCAGGGCACCAAGGAGAAGG - Intronic
1189958592 X:46303296-46303318 GTCTCAGTGAACTAAGATCAAGG - Intergenic
1190947855 X:55113394-55113416 GTCTCAGGGAAAGATGGGGAAGG - Intronic
1192181704 X:68920320-68920342 TTCTCAGGGAAGCAAGGCTAGGG + Intergenic
1193927260 X:87502586-87502608 GGCTGAGTCAACCAAGGTGATGG + Intergenic
1194610863 X:96042239-96042261 GTCTCAAAGAACTAAAGTGACGG + Intergenic
1195100425 X:101550428-101550450 GTGTCAGGGAAGGAAGGGGAGGG + Intergenic
1195717181 X:107828036-107828058 CTCACAGTCAACCAAGGTGATGG - Intronic
1198155962 X:133961146-133961168 ATCTTAGGGAACCCAGCTGAAGG + Intronic
1201325153 Y:12748446-12748468 GTCTCAGGGTCCCAAGTTGTGGG + Intronic