ID: 992828046

View in Genome Browser
Species Human (GRCh38)
Location 5:80569352-80569374
Sequence AGGTGCGCCTGCTCCGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 74}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992828046_992828058 8 Left 992828046 5:80569352-80569374 CCCATCCCGGAGCAGGCGCACCT 0: 1
1: 0
2: 0
3: 3
4: 74
Right 992828058 5:80569383-80569405 GGCTCTCTGCTAAGGGGGTCCGG 0: 1
1: 0
2: 0
3: 5
4: 115
992828046_992828054 2 Left 992828046 5:80569352-80569374 CCCATCCCGGAGCAGGCGCACCT 0: 1
1: 0
2: 0
3: 3
4: 74
Right 992828054 5:80569377-80569399 GCACCCGGCTCTCTGCTAAGGGG 0: 1
1: 0
2: 0
3: 8
4: 101
992828046_992828059 16 Left 992828046 5:80569352-80569374 CCCATCCCGGAGCAGGCGCACCT 0: 1
1: 0
2: 0
3: 3
4: 74
Right 992828059 5:80569391-80569413 GCTAAGGGGGTCCGGTATCCTGG 0: 1
1: 0
2: 0
3: 6
4: 30
992828046_992828060 24 Left 992828046 5:80569352-80569374 CCCATCCCGGAGCAGGCGCACCT 0: 1
1: 0
2: 0
3: 3
4: 74
Right 992828060 5:80569399-80569421 GGTCCGGTATCCTGGTGCCAAGG No data
992828046_992828053 1 Left 992828046 5:80569352-80569374 CCCATCCCGGAGCAGGCGCACCT 0: 1
1: 0
2: 0
3: 3
4: 74
Right 992828053 5:80569376-80569398 TGCACCCGGCTCTCTGCTAAGGG No data
992828046_992828052 0 Left 992828046 5:80569352-80569374 CCCATCCCGGAGCAGGCGCACCT 0: 1
1: 0
2: 0
3: 3
4: 74
Right 992828052 5:80569375-80569397 CTGCACCCGGCTCTCTGCTAAGG 0: 1
1: 0
2: 1
3: 15
4: 195
992828046_992828055 3 Left 992828046 5:80569352-80569374 CCCATCCCGGAGCAGGCGCACCT 0: 1
1: 0
2: 0
3: 3
4: 74
Right 992828055 5:80569378-80569400 CACCCGGCTCTCTGCTAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992828046 Original CRISPR AGGTGCGCCTGCTCCGGGAT GGG (reversed) Intronic