ID: 992838028

View in Genome Browser
Species Human (GRCh38)
Location 5:80659313-80659335
Sequence TGATGATGGTTGCACAACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 6, 2: 24, 3: 99, 4: 212}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992838028 Original CRISPR TGATGATGGTTGCACAACTC TGG (reversed) Intronic
900995150 1:6118645-6118667 TGGTGATGGTTGCACAACTCTGG + Intronic
902871954 1:19319198-19319220 TGGTGACAGTTACACAACTCTGG - Intronic
903107884 1:21100281-21100303 TGGTGATGGATGCACAACTCTGG + Intronic
903150227 1:21402552-21402574 TGATGATCATTTCATAACTCTGG - Intergenic
904720760 1:32506707-32506729 TGATGATTGTTGCTCAAGACTGG - Intronic
906048267 1:42849817-42849839 TAGTGATGTTTGCACAAATCAGG + Intronic
906849424 1:49232151-49232173 CAGTGATGGTTGCACAACTCTGG + Intronic
908026925 1:59962042-59962064 TGGTGATGGCTGTACAACTTTGG + Intergenic
908344345 1:63216405-63216427 TGGTGAAGGTTGCATAACTCTGG + Intergenic
910030296 1:82712617-82712639 TCACAATGATTGCACAACTCTGG - Intergenic
910817146 1:91303083-91303105 TGATGACTGTTGCACAACCTTGG - Intronic
911225729 1:95303760-95303782 TGGTGATGGTTGCACAACAATGG - Intergenic
911366546 1:96945829-96945851 TGTTTGTGGTTGCACAGCTCGGG + Intergenic
912820007 1:112859552-112859574 TGGTGATGGTTACACAACATAGG - Intergenic
913656339 1:120963908-120963930 TGGTAATGGTTGCACTACTTGGG - Intergenic
913704696 1:121407736-121407758 TGGTGATGGTTGTACAACTTTGG - Intergenic
914007484 1:143745141-143745163 TGGTAATGGTTGCACTACTTGGG - Intergenic
914520892 1:148415137-148415159 TGGTAATGGTTGCACTACTTGGG - Intergenic
914646298 1:149655623-149655645 TGGTAATGGTTGCACTACTTGGG - Intergenic
914866669 1:151435905-151435927 TGATGATGGTTGCACAGCCTTGG - Intronic
915939663 1:160110903-160110925 TGCCAATGGATGCACAACTCTGG + Intergenic
917781031 1:178397549-178397571 TGGTGATGGTTGCACAGCTTTGG + Intronic
918686105 1:187417982-187418004 TGATGATGGTGGCTCAGATCAGG + Intergenic
918693004 1:187505997-187506019 TGGTGATAGTTGTACAACTCTGG + Intergenic
921863806 1:220067647-220067669 TGATGATGGCTGCAAAATTATGG - Intronic
922911691 1:229223294-229223316 TGATAATAATTGTACAACTCTGG - Intergenic
922917047 1:229267142-229267164 TGGTGATGGTTGCACAACAATGG + Intergenic
924658371 1:245993821-245993843 TGGTGATGGTTTCACAACAGTGG + Intronic
924665600 1:246068488-246068510 TGCTGATGGATGCAGAGCTCAGG + Intronic
1062777649 10:167157-167179 TGGTGATGGTTGCAAAACACTGG + Intronic
1063398336 10:5715300-5715322 TTATGATGGTTACCCAACTATGG - Intronic
1064213400 10:13379938-13379960 TGGTGATGGTTGCACATCATTGG + Intergenic
1064324616 10:14338425-14338447 TGGTGACGGTTGCAGAGCTCTGG + Intronic
1065250906 10:23812594-23812616 TGGTGATGGTTGCACAACTCTGG - Intronic
1066401034 10:35076326-35076348 TCATGATAGTTGCACAACTCTGG + Intronic
1068107735 10:52640204-52640226 TGGTGAGGCTTGCACAAGTCAGG - Intergenic
1069531566 10:69223548-69223570 TGGTAATGGTTACACAACTCTGG - Intronic
1069799064 10:71071033-71071055 TGGTGATGGTTACACAGCTGGGG - Intergenic
1069817601 10:71208500-71208522 TGGTGATGGCTGCACAACATTGG + Intergenic
1070246095 10:74732515-74732537 TGGTGATGGTTGTCCAACCCAGG - Intergenic
1072496422 10:95964860-95964882 CGGTGATTGTTGCACAATTCTGG - Intronic
1072609778 10:97010483-97010505 TGGTGATGGATACACAACTCTGG + Intronic
1073117180 10:101097818-101097840 TGAGGATGGTAGCAGAAGTCAGG + Intronic
1073201934 10:101742386-101742408 TGGTGATGGTTGCACAGCTGTGG + Intergenic
1073316542 10:102585178-102585200 TGGTGATGGTTTCACAACTGTGG - Intronic
1073796542 10:106994718-106994740 TGGTGAAGGTTTAACAACTCAGG + Intronic
1074777703 10:116778439-116778461 AGATGAGGGTGGCACACCTCAGG + Intergenic
1075113430 10:119606476-119606498 TGGTGATGGTTGCACAGCAGTGG + Intergenic
1075220881 10:120583511-120583533 TGGTAATGGTTGCACAACTCTGG - Intronic
1077382455 11:2250478-2250500 TGAAGGTGTTTGCAAAACTCTGG + Intergenic
1078155657 11:8797825-8797847 GGAGGATGGTGGCACAACTTGGG - Intronic
1078563203 11:12390851-12390873 TGATGCTGTTTGCAAAACACAGG + Intronic
1079415488 11:20231735-20231757 CAATGATGGTTGCACAACAATGG + Intergenic
1080811727 11:35711116-35711138 TAATGATAGTTGCACAACTCTGG + Intronic
1080869852 11:36227669-36227691 TGGTGATAGTTGCACAAATCAGG + Intronic
1081415145 11:42805709-42805731 TGGTGATGGTAGCACAACATAGG + Intergenic
1081884163 11:46480502-46480524 GGATGAGGGTTGCACAACCCTGG - Intronic
1081961511 11:47141165-47141187 TGGTAATGGATGCACAACTCTGG - Intronic
1082016838 11:47495477-47495499 TGGAAATGGTTACACAACTCTGG + Intronic
1082031937 11:47610973-47610995 TGATGATGGTTCTACAAAGCAGG - Intergenic
1082263175 11:50093137-50093159 TGGTGATTGATGCACAGCTCTGG + Intergenic
1082812813 11:57488867-57488889 TGATCACGGTTGCAAAGCTCAGG + Intronic
1083337239 11:61930314-61930336 GGATAATGGTTGCACAACAATGG + Intergenic
1084401831 11:68948666-68948688 TGGTGATGGTTGCACAATGCTGG - Intergenic
1085072448 11:73559709-73559731 AGATGGTTGTTGCACAACACTGG + Intronic
1086490153 11:87351318-87351340 TGTTTATGCTTGCACAACTATGG + Intergenic
1087133784 11:94694093-94694115 TGATGATTGTTGCACAAGTGTGG - Intergenic
1087166858 11:95013463-95013485 TGTTGATGGTTGTACAACGATGG - Intergenic
1088295693 11:108291423-108291445 TGGTGATGGTTGCACAACAATGG - Intronic
1088594392 11:111429119-111429141 TGGTGATGGTTGCACAACATTGG - Intronic
1089133081 11:116227496-116227518 TGGTAATGGTTGCATAACTCTGG - Intergenic
1089740663 11:120579819-120579841 TGGTGGTGGTTACACAACTCAGG - Intronic
1089906945 11:122049695-122049717 TGGTGATGGTTGCACAACAATGG - Intergenic
1090449485 11:126793554-126793576 AGATGCTGGGTGGACAACTCAGG + Intronic
1092167555 12:6352104-6352126 ATATGATGATTGCACAACTCTGG + Intronic
1093130006 12:15379851-15379873 TAGTGGTGGTTGCACAACCCAGG + Intronic
1094306746 12:29028654-29028676 TCAAGATGGTGGCAGAACTCTGG - Intergenic
1100109480 12:91221507-91221529 TTATAATGGTTGCATAACTGCGG + Intergenic
1100376580 12:94021710-94021732 TGATGATGGTTGCAAAATAATGG + Intergenic
1101444019 12:104724382-104724404 TGGTGATGGTTGCACAGCCATGG + Intronic
1101535668 12:105614054-105614076 TGGTGATGGTTGCACAACAAGGG - Intergenic
1101595567 12:106161684-106161706 TGGTGATGATTGCACAACAATGG - Intergenic
1101699041 12:107154405-107154427 TGGTGATGGTTGCACAACAATGG - Intergenic
1102204165 12:111078841-111078863 TGATGATGGTGGCTTAACTGGGG + Intronic
1103464835 12:121133639-121133661 TGGGGATGGTTGCACAACTCTGG - Intronic
1103466220 12:121143952-121143974 TGATGATGGTTGCACAACTTGGG - Intronic
1103652952 12:122447323-122447345 TGGTGATGGCTTTACAACTCTGG + Intergenic
1104175508 12:126328271-126328293 TGGAGGTGGTTGCATAACTCTGG - Intergenic
1105533339 13:21240790-21240812 TGATGATGGTTTAAAATCTCAGG - Intergenic
1106006887 13:25778994-25779016 TGGTGATGGTTGCACAAGGCTGG + Intronic
1106198118 13:27511227-27511249 TAATGATGGTTGCACAGCAATGG - Intergenic
1106743303 13:32671362-32671384 TGATGATGGTTTGACCACTTGGG + Intronic
1106793162 13:33177469-33177491 TGATGCTAGTTACACAATTCTGG + Intronic
1107767403 13:43751443-43751465 TGATGATGGTTTCACAGGTATGG - Intronic
1108413554 13:50174640-50174662 TGGTGATGGTTGCAGAACAATGG - Intronic
1110616758 13:77550429-77550451 TGGTGATGGTTGCACAACCTTGG - Intronic
1111955511 13:94753168-94753190 TAATGATGGCTGCACAATTCTGG - Intergenic
1114357678 14:21930348-21930370 TAGTGATGGTTGCACAACAAAGG - Intergenic
1115307649 14:31948915-31948937 TGGTGATGGTTGCACAACATTGG - Intronic
1116980999 14:51170213-51170235 TTTTGCTGATTGCACAACTCAGG + Intergenic
1118680577 14:68237492-68237514 TGACAATAGTTACACAACTCAGG - Intronic
1119218364 14:72886409-72886431 TGGTGATGGTTGCACAAGGTGGG + Intronic
1119542141 14:75446733-75446755 TAGTGATAGTTGCACAACTCTGG + Intronic
1119812695 14:77536217-77536239 TGGTGATGGTTGCACAGCACTGG + Intronic
1121039959 14:90738016-90738038 TGGTGATGGTTACTGAACTCTGG + Intronic
1121252733 14:92511909-92511931 TAGTGATGGTTGCACAACTCTGG - Intergenic
1122557035 14:102586150-102586172 TGGTGATGGTTGCATGACTCTGG - Intergenic
1122996791 14:105269469-105269491 TGGTGGTGGTTGCTCAGCTCTGG - Intronic
1123505054 15:20933622-20933644 TGGTAATGGTTGCACAACTCTGG + Intergenic
1123562299 15:21507317-21507339 TGGTAATGGTTGCACGACTCTGG + Intergenic
1123598544 15:21944604-21944626 TGGTAATGGTTGCACAACTCTGG + Intergenic
1124486215 15:30119501-30119523 TGGTGATGGTTACACAACAATGG - Intergenic
1124541289 15:30588486-30588508 TGGTGATGGTTACACAACAATGG - Intergenic
1124757369 15:32419101-32419123 TGGTGATGGTTACACAACAATGG + Intergenic
1125008691 15:34846705-34846727 AGATGATGGTTGCACAACATCGG - Intergenic
1125997847 15:44181568-44181590 TGGTGAGGGTTGCACAACTCTGG - Intronic
1127209100 15:56753218-56753240 TGGTGATGGTTGCACAACAATGG + Intronic
1128594980 15:68936621-68936643 TGGTGGTGATTGCACCACTCTGG + Intronic
1129815901 15:78553957-78553979 TGGTGATGGTCGCACAACCCTGG - Intergenic
1129828248 15:78649912-78649934 TGAGTATGTTTGAACAACTCCGG + Intronic
1129973190 15:79798493-79798515 TGGTGATAGTTGCACAACTCTGG - Intergenic
1130316107 15:82798422-82798444 TGATGATGGCTGCACAATTTGGG - Intronic
1132349561 15:101131107-101131129 TGGTGATGGTTGCACAACAGTGG + Intergenic
1202970644 15_KI270727v1_random:234458-234480 TGGTAATGGTTGCACAACTCTGG + Intergenic
1133300787 16:4781351-4781373 CGATGATGGTTGCATAACCCTGG - Intronic
1133863762 16:9621853-9621875 TGCTGAGGGGTGCTCAACTCAGG - Intergenic
1135325555 16:21523251-21523273 TGGGGATGGTTGCCCAACACTGG + Intergenic
1137431570 16:48422101-48422123 TGTTGATGGTTGCACACCTGTGG + Intronic
1138054605 16:53819787-53819809 TGATGATGGTTGTATGCCTCTGG - Intronic
1138993515 16:62420554-62420576 TGATGATTGTTGCATGACTGAGG - Intergenic
1141215214 16:82017480-82017502 TAATGATGGTTGCACAAGTCTGG + Intergenic
1141494234 16:84395899-84395921 TGGTGATGGTTGCATAACAATGG - Intronic
1141643590 16:85355626-85355648 TGGTAATGGTAGCACAACACTGG + Intergenic
1141701576 16:85644723-85644745 TGGTGATGGTCGCACAACTCTGG + Intronic
1142038553 16:87877838-87877860 TGGGGATGGTTGCCCAACACTGG + Intergenic
1142243511 16:88957914-88957936 CAATGATGGTTGCACACCTCTGG + Intronic
1142468672 17:149907-149929 TGGTGATGGATGTACAACTCTGG - Intronic
1144142981 17:12367940-12367962 TGGTGATGGTTGTATAATTCTGG - Intergenic
1144298888 17:13904809-13904831 AGATGATGTTTGCCAAACTCTGG - Intergenic
1145122227 17:20270189-20270211 TGGTGATGGTTGCACAACATTGG + Intronic
1145235720 17:21206929-21206951 TGCTATTGGTTGCACAACTTTGG - Intronic
1146848013 17:36196860-36196882 TGCTGAGTGTTGCACAACTCAGG + Intronic
1149480192 17:56997200-56997222 TAGTGATGACTGCACAACTCTGG - Intronic
1150189492 17:63223181-63223203 AGGTGATGGTTGCACAACATTGG + Intronic
1151810554 17:76438259-76438281 TGGGGATGGTTGCACAACAATGG + Intronic
1152101302 17:78303397-78303419 TAGTGATGGTTGCACAACAATGG - Intergenic
1153001803 18:462598-462620 TGGTGGTAGTTGCACACCTCTGG + Intronic
1153088186 18:1313379-1313401 TGGTGATGGTTGCATGACTCTGG - Intergenic
1155434491 18:25797360-25797382 TGATGCTATTTGCCCAACTCTGG + Intergenic
1156043517 18:32851694-32851716 TGATGATGGCTGTACCACTAGGG + Intergenic
1156389399 18:36636416-36636438 TGATGAAGGTTGAACAAATAGGG + Intronic
1157594594 18:48856828-48856850 TGGTGATGGTTGCACAATTCTGG + Intronic
1159900967 18:74045175-74045197 TGGTGATGGCTGGAGAACTCAGG + Intergenic
1160230838 18:77047557-77047579 TAACGATGGTTGCACAGTTCTGG + Intronic
1160589686 18:79936446-79936468 TGATGGTGTTTGCACAACTGTGG - Intronic
1160839495 19:1139408-1139430 TGGTGATGGCTGAACAGCTCTGG + Intronic
1160896377 19:1404053-1404075 CGGTGATGGTTGCACAACAATGG + Intergenic
1161132599 19:2599960-2599982 TGGTAATGGTTACACAACTCTGG + Intronic
1165437640 19:35805154-35805176 TGGTGATGGTTGCACAATTTTGG + Intronic
1166033467 19:40150298-40150320 TGGTAATGGTTGCACAACTCTGG + Intergenic
1167131775 19:47591475-47591497 TGATGATGTTTGCACAGCACTGG + Intergenic
1168518879 19:57032719-57032741 TGGTGATGGCTGCACAACAATGG - Intergenic
925388698 2:3481517-3481539 TGATGATGGGCTCACAACTGTGG + Intronic
927688886 2:25193446-25193468 TGGTGATGGTTGCACAGCCTTGG + Intergenic
928236985 2:29551926-29551948 TGATGATAGTTGCACAACATTGG - Intronic
928935749 2:36676093-36676115 TGGTAATGGCTGCACAACCCTGG + Intergenic
929253839 2:39788402-39788424 CTATGATGTTTGCACAACTATGG + Intergenic
930382736 2:50652303-50652325 CAATGATGGTTGCATAACACTGG - Intronic
930990165 2:57644822-57644844 TGGTGATGGTTGCACAATTCTGG - Intergenic
931177795 2:59870908-59870930 GGGTGATGGTTGCACAGCTGGGG + Intergenic
932099757 2:68887723-68887745 TGATGATGGTTGCACAACCCTGG + Intergenic
934062619 2:88309432-88309454 TGGTGATAGTTGCACAACCTAGG + Intergenic
935087656 2:99864173-99864195 TGATGATGGCTGCATAACACAGG + Intronic
937171456 2:119874692-119874714 TGATGATGGTTGCACACCGTAGG + Intronic
937206867 2:120242318-120242340 TGATGATGGCTGCACGACACTGG + Intronic
938938810 2:136150619-136150641 TGGTGATGGTTGCATAACATTGG + Intergenic
939076845 2:137613076-137613098 TGATCATGTTTGAACCACTCTGG - Intronic
940864678 2:158806163-158806185 TGATGATGTTTGGAAAATTCTGG - Intronic
944357035 2:198802326-198802348 TGATGATGGTTAGACAACTCTGG + Intergenic
946772271 2:223100836-223100858 TGATGATAGTGGCACATCTGGGG - Intronic
947764414 2:232627933-232627955 TGACGATGGTTTTACAACTCTGG - Intronic
947974567 2:234354456-234354478 TGATAATGTTTGGAAAACTCTGG - Intergenic
948448505 2:238052798-238052820 TGGTGATGGTTGCACAACCTTGG + Intronic
948634491 2:239326436-239326458 TGGTGATGGTTGCCCAACAATGG + Intronic
948706302 2:239795520-239795542 TGATGATGGTTGTACACATTCGG - Intronic
1169192487 20:3667060-3667082 TTATGATGGTTTAACATCTCGGG + Intergenic
1169949139 20:11023629-11023651 TGATGGTGGTTGGACAACCTTGG - Intergenic
1170493510 20:16901927-16901949 TGATCAGGGTTGCACAAATAAGG - Intergenic
1173027511 20:39322626-39322648 TGATCATGTTTGAAAAACTCAGG - Intergenic
1173050471 20:39554950-39554972 TGATGATTGTGGTACAACACTGG + Intergenic
1173654072 20:44687106-44687128 TGGTGATGGTTGCGCAACAATGG - Intergenic
1174038695 20:47684065-47684087 TGGTGATGGTTATACAACTCTGG + Intronic
1174096718 20:48095717-48095739 TGGTGGTGGTTGCACAACAATGG + Intergenic
1175379255 20:58551565-58551587 TGGTGACAGTTACACAACTCTGG - Intergenic
1175528528 20:59655356-59655378 TGATGATAGTTGCACAACTCTGG - Intronic
1175853299 20:62105084-62105106 GAATGATGTTTGCACATCTCAGG + Intergenic
1177215816 21:18127224-18127246 TAATGATGATTGAACAACTCTGG + Intronic
1178574437 21:33772444-33772466 GGACGATGGTTGCACAACTTTGG - Intronic
1178677058 21:34639969-34639991 TGATGATGGTTACACAACACTGG - Intergenic
1178903331 21:36615298-36615320 TGTTGATGGTTTCACTAGTCTGG + Intergenic
1182559074 22:31145061-31145083 TGGTGACGGTTGCACAACTATGG - Intergenic
1183102011 22:35589973-35589995 TGGTGCTGGTTGCACACCTGTGG - Intergenic
949324609 3:2849335-2849357 TGGTGATAGTTGCACAACATTGG + Intronic
949343563 3:3054764-3054786 TGGTGCTGGTTGCACAACACTGG + Intronic
950760148 3:15215410-15215432 TGGGGATGACTGCACAACTCTGG - Intronic
951041006 3:17988860-17988882 TGATGATGTGTGTACAACTCTGG - Intronic
952340645 3:32442837-32442859 TAGTAATGGTTGGACAACTCTGG - Intronic
952726668 3:36593813-36593835 AGAAGATGGGTGCACAACACAGG + Intergenic
952971988 3:38657126-38657148 TTATGAAGGTGGCAGAACTCAGG - Intergenic
956217553 3:66864441-66864463 TGAGGATGGTCGTACAACTCTGG - Intergenic
959479187 3:106850570-106850592 GGATGATGGTTGCACTAGTGTGG - Intergenic
961020818 3:123505335-123505357 TGATGATGGTTGCACAACAATGG + Intronic
961541250 3:127600967-127600989 TGGTGAAGGCTGCATAACTCAGG - Intronic
961979772 3:131064638-131064660 TGTTGATGGTTGCAGACCTCTGG + Intronic
964824571 3:160810860-160810882 TGATGGTGGTTGCAGATTTCAGG + Intronic
965744385 3:171908828-171908850 TAATGATGGTTGCATAACTTTGG - Intronic
965862968 3:173169227-173169249 TGATTATGGTTGCACGAATTTGG + Intergenic
966903631 3:184506067-184506089 TGATGATGATTGCACAGCAATGG + Intronic
968020732 3:195386307-195386329 TGGTGATAGTTGTACAACACTGG + Intronic
968353956 3:198086478-198086500 AGATGCTGGTTGTACAACACTGG + Intergenic
969414298 4:7048650-7048672 TGGTGATGGCTGTACAACACTGG - Intronic
969531094 4:7730808-7730830 TGGTAATGCTTGCACAACTTAGG + Intronic
969705164 4:8787727-8787749 CCATGATGGCTGCACAACACGGG + Intergenic
970176426 4:13344155-13344177 TGGTGATGGTTGAACAACAGTGG + Intergenic
971210210 4:24609024-24609046 AGATGATGGCTGTACAACTCAGG + Intergenic
971392570 4:26199766-26199788 TGATGTTGGTTGCACAAACTTGG + Intronic
971803520 4:31323903-31323925 TGGTGATGGTTGCACAACAATGG + Intergenic
975399606 4:73919487-73919509 TGAAGATGGTGGCTCAACCCAGG - Intergenic
975757055 4:77581171-77581193 TGGTGATGGTTACACATATCTGG + Intronic
977358009 4:95970779-95970801 TGGTGATGATTGCACAACAATGG - Intergenic
977875021 4:102139511-102139533 TGCTGTGGGTTGCACCACTCTGG + Intergenic
978340087 4:107713409-107713431 TGGTGATGGCTGTACAACTCTGG + Intronic
978869516 4:113558097-113558119 AGATTATTGTTGCCCAACTCTGG - Intronic
979418645 4:120476000-120476022 TGATGAAGTTTGCTCATCTCAGG + Intergenic
979507817 4:121518158-121518180 TGATGATGGTTGCACAACTGTGG - Intergenic
982488036 4:155992432-155992454 TGATGATGGTTGCTGAAGGCTGG + Intergenic
983203765 4:164890312-164890334 TGGTGATGGTTGCACAACTTAGG - Intronic
984460590 4:180031531-180031553 TGCTGATGATTGCACAATCCTGG - Intergenic
984757822 4:183340312-183340334 TGGTGATGATTGCACAGCTCTGG - Intergenic
985416571 4:189741543-189741565 TGGTGATGGCTGCACAACAATGG - Intergenic
989397508 5:40974130-40974152 TGGTGATGGTTGCACAACAATGG - Intronic
989706841 5:44343980-44344002 TAATGATGGTTTAACAACCCAGG + Intronic
990543118 5:56794187-56794209 TGGTGATGGTTGTGCAATTCTGG - Intergenic
992838028 5:80659313-80659335 TGATGATGGTTGCACAACTCTGG - Intronic
994003812 5:94814075-94814097 AGGTGATGGTTGTACAACTCTGG + Intronic
994128843 5:96200656-96200678 TGATCAAGGATGCTCAACTCTGG + Intergenic
994573382 5:101542581-101542603 TAGTGATGGCTGCAAAACTCTGG + Intergenic
994880655 5:105490092-105490114 TGATGAAGGTGGCAGAATTCAGG + Intergenic
996786368 5:127241080-127241102 TGTTTATGGTTGCACATCTCTGG + Intergenic
996950203 5:129117282-129117304 TGATGGTGGTTGTACGACTTAGG - Intergenic
999670746 5:153957203-153957225 TGATGCTGCTTGCACAGCCCTGG - Intergenic
1002083482 5:176751969-176751991 TGCTGATGGCTGCACAACAATGG + Intergenic
1002603311 5:180367738-180367760 TGATGAAGGCCGCACGACTCTGG - Intergenic
1002850982 6:996105-996127 TGGGGAAGGTTGCACAACTCTGG + Intergenic
1003215649 6:4107699-4107721 TGACGATGGTTGCATAACAATGG - Intronic
1004361832 6:14978124-14978146 TGGTGATAGTTGCACAACTTTGG - Intergenic
1005174760 6:23032114-23032136 TGGTGATGGTTGCACAACATTGG + Intergenic
1006593400 6:35174773-35174795 TGGTGATAGTTGCACAACTTTGG + Intergenic
1009501217 6:64416983-64417005 TGATGGTGGTAGTAGAACTCTGG + Intronic
1010159340 6:72833338-72833360 TTATGATGGTTCCAGAACTTTGG - Intronic
1012565481 6:100644291-100644313 TGGTGATGGTTGTACAACTTTGG - Intronic
1013679845 6:112512730-112512752 TGGTTATGGTGGCATAACTCTGG + Intergenic
1014218277 6:118774189-118774211 TGGTGATGGTTACACAACACTGG + Intergenic
1015170817 6:130250496-130250518 AGGTGATAGTTGCACATCTCTGG - Intronic
1015301747 6:131660310-131660332 TGACCATGGTGGCCCAACTCAGG - Intronic
1015541838 6:134322002-134322024 TGTTGAAGGTTGCACAATTAGGG - Intergenic
1016810522 6:148256985-148257007 TGATAATAGGTGCACATCTCTGG + Intergenic
1017203324 6:151778316-151778338 TGGTGATGGCTGCACAACACTGG + Intronic
1018817206 6:167342592-167342614 AGGTGATGGTTGCACAACACGGG + Intronic
1020436672 7:8170960-8170982 TGGTGATGATTACACAGCTCTGG - Intronic
1021551904 7:21879753-21879775 TGATGATGATTGGTCAAGTCTGG - Intronic
1022718909 7:32924985-32925007 TGATGATGGTTGCACACACTTGG + Intergenic
1024213656 7:47228195-47228217 TGGTGATGGCTGCACAACAGTGG + Intergenic
1024488639 7:49949706-49949728 TGATGATGATTTCACAACAGTGG + Intronic
1026558446 7:71428160-71428182 TGGAGATAGTTGCACAACACTGG - Intronic
1027472138 7:78586641-78586663 TGGTGATGGTTGCACAACAATGG - Intronic
1029109696 7:98206670-98206692 TGATGATGTGTGCACACTTCAGG + Exonic
1029235914 7:99118713-99118735 TGGTGATGGTTGTACAACACTGG + Intronic
1032440184 7:131936789-131936811 TGGTGATGGTTGCAGAACAATGG + Intergenic
1032503827 7:132420646-132420668 TGGTGATGGTTGCACAACAATGG - Intronic
1034701730 7:153102239-153102261 TGGTGATGGTTGCACATATATGG - Intergenic
1036021117 8:4847865-4847887 TGGTGATGGTTGCATATATCTGG - Intronic
1036941084 8:13052898-13052920 TGGTGATGGTTGCACAACAATGG - Intergenic
1037501779 8:19493398-19493420 TGGTGATGGTTGCACAAACCTGG - Intronic
1038056651 8:23864846-23864868 GGTAGTTGGTTGCACAACTCTGG + Intergenic
1040041829 8:42923738-42923760 TGGTGATAGTTGTACCACTCTGG + Intronic
1041336673 8:56793193-56793215 TGGTGATGGCTGTCCAACTCTGG + Intergenic
1041414114 8:57588519-57588541 TGATGGTGTTTACACAACTCAGG - Intergenic
1041687569 8:60658381-60658403 TGGTGATAGTTGCACAACAGTGG + Intergenic
1043611927 8:82075400-82075422 TTATGATAGTTGCACAACTGTGG - Intergenic
1043766032 8:84133449-84133471 TGATGAAGGCTGCAGACCTCAGG + Intergenic
1044412595 8:91901356-91901378 TGGTGATGGATTCACAACTCTGG + Intergenic
1045944251 8:107777550-107777572 TGGTGATGGTTGCATAACTGTGG - Intergenic
1047180921 8:122586951-122586973 AGGTGGTGGTTGCACAACACTGG + Intergenic
1048302452 8:133261429-133261451 TGCTGAAGGTTGCACAGCTGAGG - Intronic
1050045131 9:1535154-1535176 AGGTGACGGTTGCACAACACTGG - Intergenic
1050349837 9:4730254-4730276 AGGTGATGGTTGCACAACTTTGG + Intronic
1051222309 9:14862574-14862596 TCATGATGGTTGTACAACCTTGG - Intronic
1056872391 9:90294224-90294246 TGGTAATGGTTGCAAAACTGTGG - Intergenic
1057070743 9:92097741-92097763 TGGTGATAGTTGTATAACTCTGG + Intronic
1057325507 9:94059975-94059997 TGATGATTGTTCCACATCTGGGG + Intronic
1057525882 9:95800690-95800712 TGGTGATGGGTGCCCAACTCTGG + Intergenic
1057967395 9:99517570-99517592 TGGTGATGGTTACACAACAATGG - Intergenic
1057987744 9:99734331-99734353 TGGTGATGGTTGCAAAACAATGG + Intergenic
1057992308 9:99783148-99783170 TGGTGGTGGTTTCACAATTCTGG - Intergenic
1058191845 9:101926722-101926744 TGGTGATGCTTGCACAACTCTGG - Intergenic
1058992345 9:110266692-110266714 TGGTGATAGTTGCATAACTTTGG + Intergenic
1059129286 9:111728741-111728763 TGGTGATGATTGCACAACTCTGG + Intronic
1060323251 9:122585796-122585818 TTGTGATGGGTGCACAATTCTGG + Intergenic
1185942120 X:4333455-4333477 TGGTTATGGGTCCACAACTCAGG - Intergenic
1186565983 X:10663195-10663217 TGATGATGGTTGTAGGACACTGG - Intronic
1186602714 X:11055673-11055695 TGATGATGGTCTCCCAACTCAGG - Intergenic
1186923959 X:14311693-14311715 TGTTGACAGTTGGACAACTCTGG + Intergenic
1187546232 X:20255405-20255427 TGGTGATGGCTGCACAACCTTGG + Intronic
1187910334 X:24105401-24105423 TGGTGGTGGTTGCATAACTTTGG - Intergenic
1188435849 X:30157648-30157670 TGGTTATGGTTGCACAACAATGG + Intergenic
1190894305 X:54601278-54601300 TGATGGTGGTTGCACAATCCTGG + Intergenic
1191085710 X:56564851-56564873 TGCTGGTAGTTGCAGAACTCTGG - Exonic
1191983380 X:66951317-66951339 TGAGGATGGGTGCAAAAATCAGG + Intergenic
1192413613 X:70957204-70957226 TGATGATGGTTGCACAACAATGG + Intergenic
1192524141 X:71827117-71827139 TGGTGATGGTTGCACAGCAATGG + Intergenic
1192559582 X:72117502-72117524 TGGTGATGGCTGTGCAACTCTGG - Intergenic
1193408520 X:81134489-81134511 TGGTGATGGTTGCACAATTCTGG - Intronic
1193730965 X:85102379-85102401 TGGTGCTGGTTGCACAACAATGG + Intronic
1193787355 X:85775426-85775448 TGGTGATGGTTGCACAACAATGG - Intergenic
1193801260 X:85939173-85939195 TTATGATGTTTGCACAACTATGG + Intronic
1194359097 X:92925780-92925802 TGATAATGATTTCACAACTTTGG + Intergenic
1194554812 X:95343033-95343055 TGGTGATTGTTGCACAACAATGG + Intergenic
1195805434 X:108760337-108760359 AGGTGATGGTTGTACAGCTCTGG - Intergenic
1197322426 X:125049158-125049180 TGGTAATGGTTGCACAGTTCTGG - Intergenic
1197660987 X:129171921-129171943 TAATGATGGTTGTGCAACTCTGG + Intergenic
1197799353 X:130333497-130333519 TGGTGATGGTTGCACAACATTGG + Intergenic
1198322058 X:135527979-135528001 TGATAGTGGTTCCACATCTCAGG + Intronic
1198886145 X:141339978-141340000 TGGTGATTGCTGTACAACTCTGG + Intergenic
1199685599 X:150262499-150262521 TGATGGTGGTTTCTCAACTCAGG + Intergenic
1200667305 Y:6041786-6041808 TGATAATGATTTCACAACTTTGG + Intergenic
1200667422 Y:6043950-6043972 TTATGATGCTTGCACAAATTTGG - Intergenic
1201376591 Y:13329590-13329612 TGATAATGATTGCACACATCTGG + Intronic
1201551752 Y:15224722-15224744 GGATGCTGTTTGAACAACTCAGG + Intergenic
1201671464 Y:16526150-16526172 TGATGATGTTTGCACAGCACTGG + Intergenic
1201731093 Y:17204052-17204074 AGGTGATTGTTGCACAACACTGG + Intergenic
1202188560 Y:22216554-22216576 AGATGATGGTTATACAACTAAGG + Intergenic