ID: 992843453

View in Genome Browser
Species Human (GRCh38)
Location 5:80719511-80719533
Sequence AAGAACCAGGATTGTCGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992843453_992843455 13 Left 992843453 5:80719511-80719533 CCATGTCGACAATCCTGGTTCTT 0: 1
1: 0
2: 0
3: 10
4: 91
Right 992843455 5:80719547-80719569 GATTTTATCATTCAAATATCAGG 0: 1
1: 0
2: 2
3: 33
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992843453 Original CRISPR AAGAACCAGGATTGTCGACA TGG (reversed) Intronic
904472184 1:30742723-30742745 AAGACCCAGGATTCTGAACATGG - Intronic
913125132 1:115779896-115779918 AAGAATCAGCATTGTGGAAATGG + Intergenic
917069013 1:171128509-171128531 AAGCACCAGGACTGTCCACATGG + Intergenic
918680878 1:187351397-187351419 AAAAAGCAGGATTGTCTAGAGGG - Intergenic
919277038 1:195433751-195433773 AAGAAAAAGGATTGTCAAAAGGG + Intergenic
923712886 1:236400995-236401017 AAGAACCAGGCTGGCCAACATGG + Intronic
1064620128 10:17206855-17206877 AAGAACCAGGATTGCTGTGAAGG + Intergenic
1065482554 10:26210390-26210412 AAGAACCAAGAATGTCGCCAAGG - Intronic
1068253562 10:54476736-54476758 AAGAACCTGGAGTGTAGAAAAGG - Intronic
1069772021 10:70906156-70906178 AAGAAACAGGATGGTCCCCATGG - Intergenic
1074002166 10:109384143-109384165 AAGAAAAAGGATTGTGGACCAGG - Intergenic
1079440187 11:20506017-20506039 AAGAACTAGGATTTTCAGCAAGG - Intronic
1079728523 11:23908668-23908690 AAGAACCAGTATTGTTAAAATGG - Intergenic
1081228429 11:40554559-40554581 AAGAATCAGTATTGTTAACATGG - Intronic
1088198371 11:107301397-107301419 AAGAACCAAGATTTTCAGCATGG - Intergenic
1089012410 11:115141910-115141932 AAGAGCCAGGATTATTGGCAGGG + Intergenic
1089260017 11:117217909-117217931 ATGAACCAGGATTGTCTGAAGGG - Intronic
1089906060 11:122039937-122039959 AATAACCAGGAGAGTGGACATGG + Intergenic
1094453552 12:30606955-30606977 AAGAATCAGTATTGTCAAAATGG + Intergenic
1096943163 12:55372168-55372190 AAAAACCAGAATTATCAACAGGG - Intergenic
1098822623 12:75252265-75252287 AAGAACCAGGATTTAAGACATGG + Intergenic
1100114870 12:91292295-91292317 AAGAACCAGTATTGTTAAAATGG - Intergenic
1101081364 12:101188616-101188638 AGGAAACAGGATTGACGAGAGGG - Intronic
1102087078 12:110150550-110150572 AAGAACCAAGATTTTCAACGTGG - Intronic
1102819592 12:115896289-115896311 AAGACCCAGAATTGTCACCAAGG - Intergenic
1104084534 12:125461870-125461892 GAGAACCAGGCTTGTGGACGAGG - Intronic
1110611929 13:77498399-77498421 GAGAACCATGATGGTCCACAGGG - Intergenic
1113302626 13:109038519-109038541 GAGACCCAGGAAAGTCGACAAGG - Intronic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1117355085 14:54915920-54915942 AAGATCCAGGATTGACAACCAGG + Intergenic
1126675458 15:51156388-51156410 CAGACCCAGCATTGTAGACAAGG - Intergenic
1129566508 15:76628870-76628892 AAGAACCAGTATTGTTCAAATGG - Intronic
1133397492 16:5459918-5459940 AAGAACTCGGAGTGGCGACACGG - Intergenic
1134767204 16:16770594-16770616 AAGAAACAGTATTGTGGAAATGG - Intergenic
1135616210 16:23913211-23913233 AAGAACCATGAATATGGACAAGG + Intronic
1143379481 17:6487117-6487139 AAGAACCAGGAGTGATGGCAGGG + Intronic
1144673346 17:17145482-17145504 AAGAAGCAGGATGGCAGACAGGG - Intronic
1149241773 17:54659124-54659146 AAGAACCAGTATTGTGAAAATGG - Intergenic
1158782469 18:60667813-60667835 AAGACCCAGGATTTTCCACCAGG + Intergenic
1159465283 18:68774425-68774447 AAGAACCAGGATTTGCAACACGG - Intronic
1159990905 18:74906129-74906151 AAAAACCAGGAATGCCTACAAGG - Intronic
930729210 2:54711073-54711095 TAGAGCCAGGATTCTGGACAGGG - Intergenic
930992778 2:57680120-57680142 AAGAACCAGGCTTTTTGGCATGG + Intergenic
935271282 2:101436281-101436303 ATGAACCAGGATTGTAGCAAAGG - Intronic
936120834 2:109742696-109742718 AAGACCCAGAATAGTCAACATGG + Intergenic
936223863 2:110628777-110628799 AAGACCCAGAATAGTCAACATGG - Intergenic
940108013 2:150119906-150119928 CAGAACCAGGATTGGGGACCAGG - Intergenic
941783238 2:169471960-169471982 AAGAGCTGGGATTGTAGACATGG - Intergenic
943140301 2:183974081-183974103 AAGAATCAGTATTGTGAACATGG - Intergenic
943163507 2:184285279-184285301 AAGAATCAATATTGTGGACATGG + Intergenic
945060158 2:205901783-205901805 AAGACCCAGTCTTGGCGACAGGG + Intergenic
1172551237 20:35801848-35801870 AAGAAGCAGGAATGGCTACAGGG + Intronic
1174089250 20:48033916-48033938 ATTAACCTGGATTGTCCACAAGG - Intergenic
1175350546 20:58315023-58315045 AAGAACCAGGAGAGACGGCAGGG + Intronic
1177256151 21:18665059-18665081 AAAAACCAGCATTATCGTCAGGG - Intergenic
950861389 3:16150488-16150510 CAGCACCAGGTTTGTCCACAAGG + Intergenic
953588442 3:44227765-44227787 AAGAGGCAGGATTGTGGTCAGGG + Intergenic
958463023 3:94422826-94422848 AAGAATCAGTATTGTCAAAATGG + Intergenic
959207279 3:103325810-103325832 AAGTCCCAGGATTGTATACAGGG + Intergenic
964297375 3:155248763-155248785 AAGAACCAGGATTTAAGGCAAGG - Intergenic
965450819 3:168835631-168835653 TAAAACTAGGATTGTAGACATGG + Intergenic
966454981 3:180104352-180104374 AAGAACCAGTATTGTGAAAATGG + Intergenic
969834223 4:9826342-9826364 CAAAAACAGGATTGTCTACATGG - Exonic
971827870 4:31650404-31650426 AGGAACCAGGATTTTAGACCAGG - Intergenic
973674045 4:53246237-53246259 AAGAATCAGCATTGTCAAAATGG + Intronic
974854231 4:67440430-67440452 AAGAACCAGTATTGTGAACATGG + Intergenic
981828615 4:148974086-148974108 AAGAAAAAGAATTGTCGACCGGG - Intergenic
990024141 5:51164752-51164774 AAGAATCAATATTGTCAACATGG + Intergenic
992489269 5:77225779-77225801 AAGAACCAGGATTTATGTCATGG - Intronic
992843453 5:80719511-80719533 AAGAACCAGGATTGTCGACATGG - Intronic
1001012922 5:168114931-168114953 AAAAAACAGGATTGTCTAGAAGG - Intronic
1002462098 5:179379065-179379087 AAGAACCAGGATGCAGGACAAGG - Intergenic
1005699332 6:28384116-28384138 AAGAACCTGGATTCTAGAGACGG - Intronic
1013200296 6:107888191-107888213 AAGAATCAGTATTGTCAAAATGG - Intronic
1014236750 6:118965709-118965731 AAGAGCCAGGATTGTAGGCAAGG - Intronic
1016915220 6:149238218-149238240 AAGAACCAGGAAACTCCACATGG + Intronic
1020821654 7:12975885-12975907 AAGAACCAGGATTCTCAGCATGG - Intergenic
1022764556 7:33396548-33396570 AAGAATCAGTATTGTGCACATGG + Intronic
1024191340 7:47014498-47014520 AAGAACCAGGATTGTGAAAGAGG + Intergenic
1028732298 7:94165563-94165585 TAAAACCAGGGTTGTCGACATGG - Intergenic
1030773175 7:113499949-113499971 AAAATCCAGGATTCTTGACATGG - Intergenic
1031330247 7:120455076-120455098 AAGAATCAGGATTGTTAAAATGG + Intronic
1034509972 7:151526073-151526095 AAGAAACAAGATTGTCGACCAGG - Intergenic
1034510023 7:151526433-151526455 AAGAAACAAGATTGTCGACCAGG - Intergenic
1035842350 8:2826400-2826422 AAAAACCATGATGGTCGAGAAGG + Intergenic
1035993886 8:4523817-4523839 AAGAAACAGTATGGTTGACATGG - Intronic
1037771754 8:21805225-21805247 AAGAAACAGAATTGTAGACTAGG - Intronic
1039012219 8:33106189-33106211 TAGAACCAGGACTTTTGACAGGG - Intergenic
1042442770 8:68847323-68847345 AAGAACAATGATTGTCTCCAAGG + Intergenic
1044912730 8:97078530-97078552 GAGAGCCAGGATTGTAGGCAGGG - Intronic
1046959732 8:120097949-120097971 AAGAATCAGTATTGTCTAAATGG - Intronic
1047661800 8:127045527-127045549 AAGAATCAGTATTGTCAAAATGG + Intergenic
1051619273 9:19034942-19034964 GAGTACCATGATTGTTGACAAGG - Intronic
1062060105 9:134490763-134490785 AAGCACCAGGATTGTGCACGTGG - Intergenic
1188752720 X:33923624-33923646 AAGAAGCAGGCTTGTCCCCAAGG + Intergenic
1188801011 X:34529686-34529708 AAGAACCATGACTGTAGCCAAGG - Intergenic
1191767824 X:64719674-64719696 GGGAACCAGGATTATCAACAGGG + Intergenic
1193755431 X:85403612-85403634 AAGAACCAGTATTGTGAAAACGG - Intergenic
1194912953 X:99669873-99669895 AAGAATCAGTATTGTGAACATGG - Intergenic
1196983674 X:121243665-121243687 AGGAACCTGGATTATCTACAAGG - Intergenic
1197133184 X:123029854-123029876 TAGAAGCAGGATTGTTAACAGGG - Intergenic
1200484583 Y:3751577-3751599 AAAAACAAGGAATGTGGACATGG + Intergenic