ID: 992853357

View in Genome Browser
Species Human (GRCh38)
Location 5:80834216-80834238
Sequence CTGTGGGACTCACACCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 197}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992853357_992853364 11 Left 992853357 5:80834216-80834238 CCTCCAGGGTGTGAGTCCCACAG 0: 1
1: 0
2: 0
3: 16
4: 197
Right 992853364 5:80834250-80834272 AATAACAGGCCTAATAGTCCTGG 0: 1
1: 0
2: 0
3: 4
4: 73
992853357_992853365 12 Left 992853357 5:80834216-80834238 CCTCCAGGGTGTGAGTCCCACAG 0: 1
1: 0
2: 0
3: 16
4: 197
Right 992853365 5:80834251-80834273 ATAACAGGCCTAATAGTCCTGGG 0: 1
1: 0
2: 0
3: 4
4: 68
992853357_992853361 -3 Left 992853357 5:80834216-80834238 CCTCCAGGGTGTGAGTCCCACAG 0: 1
1: 0
2: 0
3: 16
4: 197
Right 992853361 5:80834236-80834258 CAGAGCCGCCTCAGAATAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992853357 Original CRISPR CTGTGGGACTCACACCCTGG AGG (reversed) Intronic
900580257 1:3405201-3405223 CTGTGGTGCTGAGACCCTGGCGG - Intronic
901453286 1:9349147-9349169 CAGAGGGATACACACCCTGGAGG - Intronic
901879305 1:12184781-12184803 CTGTGGTTCTCAGGCCCTGGAGG + Intronic
903027052 1:20436859-20436881 CTGTGGGCCTCACACACAGTAGG - Intergenic
904407947 1:30305882-30305904 TTGGGGCACTCAAACCCTGGGGG - Intergenic
905270630 1:36785318-36785340 CTGTGGGGCTCATAGTCTGGAGG + Intergenic
907398472 1:54209126-54209148 CTGTAGCACTCACTACCTGGTGG + Intronic
907573873 1:55508015-55508037 TTGTGGAACTCACAGCTTGGAGG - Intergenic
908754757 1:67459175-67459197 CAGAGGGACTCAAAGCCTGGGGG + Intergenic
915676958 1:157540955-157540977 CTGTGTGACTCACCCACTCGGGG - Intronic
915686756 1:157641898-157641920 CTGTGTGACTCACCCACTCGGGG - Intergenic
917796853 1:178538807-178538829 CTGTGGGAGCCACGCCCAGGTGG - Intronic
918120935 1:181539628-181539650 CAGTGGGACTCAGACCTTGCGGG - Intronic
918471814 1:184883095-184883117 CTGTGGGACTGACACTCTCAGGG + Intronic
922222355 1:223618391-223618413 CATGGGGACTCAGACCCTGGTGG - Intronic
1063021999 10:2138011-2138033 ATGTGAGCCTCACTCCCTGGGGG + Intergenic
1067158458 10:43802370-43802392 CTGTTGGCCTCACAACCTGCTGG - Intergenic
1067688189 10:48480528-48480550 CTGTGGATCTCACACCCTACTGG - Intronic
1067804708 10:49384717-49384739 TTGTGGCTCCCACACCCTGGGGG - Intronic
1069625845 10:69867230-69867252 CTGTGGGTGGCAGACCCTGGAGG + Intronic
1069752786 10:70754876-70754898 CTCTGTGGCTCAGACCCTGGAGG + Intronic
1070562560 10:77578853-77578875 CTGTGGGGCTCACATCCCAGTGG - Intronic
1070795968 10:79216418-79216440 CTGTGGGTCCCAGAGCCTGGTGG - Intronic
1073300906 10:102470545-102470567 GTGTGGGACTCACAACAGGGTGG - Intronic
1073800077 10:107032098-107032120 CTGTGGGACTAAGACTCTGAAGG + Intronic
1074438100 10:113451826-113451848 CCCTGGGCTTCACACCCTGGAGG + Intergenic
1076002060 10:126920061-126920083 CTGTGGGAAGCACCCACTGGGGG + Intronic
1076589852 10:131575399-131575421 CTGTGGGACCCACTGGCTGGCGG - Intergenic
1076660933 10:132055776-132055798 CAGTGGGACACAAACCCCGGGGG - Intergenic
1077351878 11:2096874-2096896 CTGTGGGGCAGACAGCCTGGGGG - Intergenic
1077419036 11:2440955-2440977 CTGTGGGCCTCTGACCCTGCTGG + Intergenic
1085300654 11:75456382-75456404 CTGTGGCACCCACCCTCTGGGGG - Intronic
1085410375 11:76287301-76287323 TCATGGGACTCACAACCTGGTGG - Intergenic
1085533055 11:77202980-77203002 GTGGGGGTCTCACAACCTGGGGG + Intronic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1091027965 11:132158978-132159000 CAGTGAAACCCACACCCTGGGGG - Intronic
1091307280 11:134544361-134544383 CTGTGGGAGGAAGACCCTGGAGG - Intergenic
1091404250 12:199111-199133 ATGTGTATCTCACACCCTGGGGG - Intronic
1091648311 12:2290400-2290422 TTGTGGGACTGCCACCCTGCAGG - Intronic
1092172523 12:6383075-6383097 TGGTGGCACTCACAGCCTGGTGG + Intronic
1096516024 12:52155747-52155769 CTGGGGGACTCACGCCCCAGAGG + Intergenic
1097439103 12:59587605-59587627 CTCTGGGTCTCACAATCTGGGGG - Intergenic
1101145234 12:101834480-101834502 TTGTGGGATTTACACTCTGGAGG + Intergenic
1104770923 12:131363765-131363787 CTGTGGGACTGTGACTCTGGGGG + Intergenic
1104951041 12:132440209-132440231 GCGAGGGACTCACAGCCTGGGGG + Intergenic
1107411704 13:40163988-40164010 CTCTGGGCCTCAGACCATGGAGG + Intergenic
1113617698 13:111692835-111692857 CTTTGGTCCCCACACCCTGGGGG - Intergenic
1113623229 13:111778096-111778118 CTTTGGTCCCCACACCCTGGGGG - Intergenic
1115025741 14:28743504-28743526 CAATGGGACTCACAGTCTGGTGG - Intergenic
1121347109 14:93144310-93144332 CGGTTGGACGCCCACCCTGGGGG + Intergenic
1122036200 14:98950979-98951001 CTGTGAGTCTCACAACCTAGAGG + Intergenic
1122159415 14:99772506-99772528 ATGTGAAACTCACCCCCTGGGGG + Intronic
1122899713 14:104777343-104777365 CTGGGGCACACACACACTGGAGG + Intronic
1126284564 15:46996454-46996476 CTGTGGGCCTGAGACCCTAGGGG - Intergenic
1126738158 15:51751939-51751961 GCGCGGGACTCACACCCCGGCGG - Intronic
1126795787 15:52259806-52259828 CTGTTGGACTTGCACCCAGGTGG - Intronic
1128240677 15:66099136-66099158 GGGTGGGAGTCACACCCTGCAGG - Intronic
1128261287 15:66234873-66234895 CTCTGGGACTCCCCCACTGGAGG - Intronic
1128672360 15:69583782-69583804 CTGTGGAAGTCACACTCTGTAGG + Intergenic
1129177359 15:73849601-73849623 CTGTGGGACACCCACCTTTGGGG - Intergenic
1131048699 15:89332926-89332948 ATGTGGGACTCACTTTCTGGTGG - Intronic
1132240246 15:100252369-100252391 CTGAAGGACACACAGCCTGGAGG + Intronic
1133921449 16:10156955-10156977 CTGTGGGAGACAGAGCCTGGTGG + Intronic
1136048475 16:27633953-27633975 CTGGAGGACACACAGCCTGGAGG + Intronic
1137686214 16:50388737-50388759 TTGTGGGCCTCCTACCCTGGTGG + Intergenic
1137721188 16:50628408-50628430 CTGTGGGACTTACAGGCAGGAGG + Intronic
1138397300 16:56715177-56715199 CCGTGGGACACACAAGCTGGAGG - Intronic
1141903788 16:87009479-87009501 CTGTGGAAGCCACTCCCTGGTGG + Intergenic
1142914471 17:3124704-3124726 CCTTGGGCCTTACACCCTGGGGG - Intergenic
1144656051 17:17037465-17037487 CTGTGGTTCTCAAATCCTGGAGG - Intergenic
1144855884 17:18267596-18267618 CTGTGCCACTCGCACCCTGCTGG + Intergenic
1144875469 17:18394909-18394931 CTGTGGGGCTGACTCCCAGGAGG - Intergenic
1145156756 17:20549512-20549534 CTGTGGGGCTGACTCCCAGGAGG + Intergenic
1145798934 17:27671396-27671418 CTGTGGGGCTGACTCCCAGGAGG + Intergenic
1146160143 17:30555217-30555239 CTGTGGGGCTGACTCCCAGGAGG - Intergenic
1146844267 17:36173600-36173622 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1146856572 17:36261535-36261557 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1146864045 17:36326840-36326862 CTGTGGGGCTGACTCCCAGGAGG - Intronic
1146879840 17:36436531-36436553 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1147066905 17:37927428-37927450 CTGTGGGGCTGACTCCCAGGAGG - Intronic
1147075366 17:37986070-37986092 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1147078437 17:38006989-38007011 CTGTGGGGCTGACTCCCAGGAGG - Intronic
1147086891 17:38065616-38065638 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1147094375 17:38130924-38130946 CTGTGGGGCTGACTCCCAGGAGG - Intergenic
1147102836 17:38189579-38189601 CTGTGGGGCTGACTCCCAGGAGG + Intergenic
1147456214 17:40539804-40539826 CAATGGTATTCACACCCTGGGGG + Intergenic
1147490860 17:40864793-40864815 CTGTCTGACTCACATCCTCGTGG + Exonic
1147769170 17:42856023-42856045 CTGTGGGTGTCACCCTCTGGGGG + Intronic
1148174317 17:45550521-45550543 ATTTGGGCCTCAGACCCTGGTGG + Intergenic
1148274945 17:46294926-46294948 ATTTGGGCCTCAGACCCTGGTGG - Intronic
1148297052 17:46512505-46512527 ATTTGGGCCTCAGACCCTGGTGG - Exonic
1148361605 17:47016985-47017007 ATTTGGGCCTCAGACCCTGGTGG - Intronic
1149847410 17:60016046-60016068 CTGTGGGGCTGACTCCCAGGAGG + Intergenic
1150085768 17:62272663-62272685 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1152230479 17:79111841-79111863 CTGGGGAACACAGACCCTGGGGG + Intronic
1152339478 17:79716286-79716308 GTGTGGGGCTGACACCCAGGAGG + Intergenic
1154215740 18:12414821-12414843 ATTTGGGCCACACACCCTGGTGG - Intronic
1155169132 18:23254241-23254263 CTGTGGGTCACACTGCCTGGGGG - Intronic
1157856070 18:51106885-51106907 CTGTGGTCCTCACTCCCAGGAGG + Intergenic
1160006882 18:75074647-75074669 CTGTGTGCCTCCCACCCTGGGGG + Intergenic
1160898071 19:1412179-1412201 CTGTGGACCCCACACCCTGCAGG + Intronic
1163132820 19:15286308-15286330 CCGTGGTACTCACAGGCTGGAGG + Intronic
1164545929 19:29162905-29162927 TTGGGGGACTCTCACCCTGGTGG - Intergenic
1164672713 19:30082003-30082025 CTGGGAGACTCCTACCCTGGTGG - Intergenic
1164744529 19:30601426-30601448 CTGTGGGACACAGCCCCTGATGG + Intronic
1165096761 19:33413787-33413809 CTGTGAGGCTTACAGCCTGGGGG + Intronic
1165793705 19:38506830-38506852 CGGTGGGACCCACCCCCTGCTGG + Exonic
1165806932 19:38586147-38586169 CTTCGAGACTCACACGCTGGAGG + Exonic
1166384323 19:42371688-42371710 CTGGGGGACTCTCAGACTGGTGG + Intronic
1167619029 19:50551175-50551197 GTGGGGGACACTCACCCTGGTGG + Intronic
1168044912 19:53787673-53787695 CTGTGGCACTCAAACTGTGGGGG + Intergenic
1168281018 19:55305360-55305382 CTGTGAGACTCACTCCGGGGAGG - Exonic
1168605745 19:57758819-57758841 CTGTGGGACTCACAGGCTTGTGG - Intergenic
925875617 2:8308962-8308984 CAGTGGGACTCACAGGGTGGCGG + Intergenic
927055258 2:19360836-19360858 CTCTGGGAGGCACAGCCTGGGGG - Intergenic
927570186 2:24152769-24152791 CTGGGGAACTCACACCCTGAAGG - Intronic
930469557 2:51795213-51795235 CAGTGGGTCTCATAGCCTGGGGG + Intergenic
932238691 2:70141219-70141241 CTGAGCGTCTCACACCCTAGGGG + Intergenic
933793468 2:85902165-85902187 CTCTGGCACTCACAGGCTGGGGG - Intergenic
935844404 2:107149196-107149218 CTGTGGGCCTCTCAGCCTAGGGG - Intergenic
936401908 2:112171103-112171125 CTGTGCGACAGACACCCTAGTGG + Intronic
937440321 2:121909714-121909736 CTCTGGGCCACACACTCTGGAGG + Intergenic
940376711 2:152966133-152966155 CTGTTGAACTTACACCCTGAGGG + Intergenic
941728518 2:168890175-168890197 GTTTGGGCCTCACAGCCTGGTGG - Intronic
942323202 2:174753837-174753859 CTGTGGGTCACACACCCAGGAGG + Intronic
942678801 2:178455272-178455294 CAGTGAGACTCACATCATGGTGG + Intronic
944479935 2:200145978-200146000 CTGTGGAACTCACACTCAGGTGG + Intergenic
948066751 2:235086979-235087001 CTGTGGGACGCACAGCGTGTGGG - Intergenic
1169415271 20:5410779-5410801 CTGTTGGAATCACAGCCTAGAGG - Intergenic
1171816187 20:29787783-29787805 CTGTGGGACTCGCATTCTGGAGG - Intergenic
1172434654 20:34920532-34920554 CTGTGTGAACCACACCCTGTGGG - Exonic
1173242138 20:41306514-41306536 CTGTGGTACTCACAGTCTAGTGG - Intronic
1176088246 20:63307678-63307700 CTGTGGGGACCACACCCGGGTGG - Intronic
1179793950 21:43771523-43771545 CCGTGGGGCTCACAGCATGGGGG - Intergenic
1180932099 22:19599246-19599268 CTTTGGGAGTCCCAGCCTGGAGG - Intergenic
1185030524 22:48440667-48440689 TTGTGGGACACACATCCTGCGGG + Intergenic
1185130331 22:49035278-49035300 CTATGGGACTCACCTTCTGGCGG + Intergenic
1185137560 22:49081321-49081343 GGCTGGGACTCACACCCTGGAGG + Intergenic
1185332435 22:50257797-50257819 CCCTGGGACTCACACCCTGTCGG - Intronic
951091283 3:18576637-18576659 CTGTGGTCCTCACAGCCTTGAGG + Intergenic
953559236 3:43971887-43971909 CTGTGGGTGTCTCACTCTGGGGG - Intergenic
954707535 3:52489005-52489027 CCGTGGGACTGTGACCCTGGAGG - Intronic
954811513 3:53251177-53251199 CTGTGGGTCAGAAACCCTGGGGG + Intronic
955303178 3:57803682-57803704 CTGTCTGACTCAAACTCTGGAGG + Intronic
955380122 3:58431698-58431720 CAGTGGGAAGCAGACCCTGGAGG - Intronic
958771263 3:98428656-98428678 CTGTGGTACTGCCACCCAGGAGG - Intergenic
962292364 3:134147296-134147318 CTCTGGGGCTCAAACCCTGGGGG + Intronic
968084073 3:195866872-195866894 CTGTGGGGCTCACTCACTTGTGG + Exonic
968804106 4:2761666-2761688 CTGTGAGCCCCACCCCCTGGCGG - Intergenic
969443798 4:7232893-7232915 CTGGGGGACCCCCACCCTTGGGG + Intronic
969537290 4:7764295-7764317 CTGTGGGACACACAGACAGGAGG + Intronic
973260928 4:48162256-48162278 CAGTGGCACTCCCACGCTGGAGG + Intronic
983462562 4:168046603-168046625 CTGTGGGTCTCAAATCCTTGTGG + Intergenic
983910833 4:173236767-173236789 CTAAGGGAGTCACAGCCTGGAGG - Intronic
985595926 5:787808-787830 CTGTGGGACACACCCCCACGGGG - Intergenic
986017650 5:3771698-3771720 CTTTGGAATTCACAGCCTGGAGG - Intergenic
988410351 5:30878095-30878117 CAGTGGGGCTCACACCCCGCTGG - Intergenic
992183876 5:74225006-74225028 CTGTGGGACTGACACTCTTCTGG - Intergenic
992671134 5:79062284-79062306 TTGTGGAACTCACATTCTGGTGG - Intronic
992853357 5:80834216-80834238 CTGTGGGACTCACACCCTGGAGG - Intronic
994150769 5:96445277-96445299 CTGAGGTACACACACCATGGTGG + Intergenic
998013690 5:138715603-138715625 GTGTGGGTGTCACACACTGGAGG + Intronic
999187757 5:149725417-149725439 CTGTGGTTCTCAGACTCTGGAGG - Intergenic
1001775761 5:174328016-174328038 ATGTGCTGCTCACACCCTGGGGG + Intergenic
1001963882 5:175896622-175896644 CTGTGTGACTCTGAGCCTGGTGG - Intergenic
1008016786 6:46529506-46529528 CTATCTGACTCACACCCTGGGGG + Intergenic
1010971102 6:82264314-82264336 CTGTGGACCTCACCTCCTGGAGG + Intergenic
1011091531 6:83607269-83607291 ATGAGGAACTCACACTCTGGTGG - Intronic
1011557768 6:88587713-88587735 CCCTGGGACTCAGACCCTGCAGG - Intergenic
1015474768 6:133648083-133648105 CTTTGGGACTAGCACACTGGGGG - Intergenic
1016901352 6:149106153-149106175 CTTTGGGACCCTCACCCTGGAGG + Intergenic
1016937268 6:149456633-149456655 CTGGGGTCCTGACACCCTGGGGG - Intronic
1017294193 6:152775465-152775487 CTGTGGCAGACACACCCTGAAGG + Intergenic
1021695277 7:23270102-23270124 CTGTGTGAACCTCACCCTGGGGG + Exonic
1022516846 7:30980374-30980396 GTCCGGGACTCACACCCAGGAGG + Intronic
1024775002 7:52773849-52773871 CCCTGTGACTCACACCCTTGTGG - Intergenic
1029189239 7:98760195-98760217 CTTTGCGTCTCACATCCTGGGGG + Intergenic
1029578467 7:101419695-101419717 CCGTGGAAATCTCACCCTGGTGG - Intronic
1029956829 7:104649229-104649251 CTGAGGAACTCACAGTCTGGAGG + Intronic
1032400340 7:131620070-131620092 CTGTGGGCCTCACACCCTCTAGG + Intergenic
1033262844 7:139858557-139858579 CTGTGGCACTTACAGCCTAGTGG - Intronic
1036651087 8:10644457-10644479 CTGGGGGACTTACACCCATGTGG - Intronic
1037060111 8:14497436-14497458 TTGTTTGACTCACACCCTGCAGG + Intronic
1039166823 8:34690771-34690793 CTGTGAGACTCACACCACAGGGG - Intergenic
1039451298 8:37676879-37676901 CAGTGAGACTCCCACCCTGCAGG + Intergenic
1040279018 8:46028569-46028591 CTCTGGAACTTCCACCCTGGTGG - Intergenic
1041169193 8:55123723-55123745 CTGTGGGACACACACACAGCAGG - Intronic
1042337600 8:67644808-67644830 CTGTGGTACTCACACCCCTTGGG + Intronic
1046773279 8:118137544-118137566 CTGAGGGATGCACATCCTGGTGG - Intergenic
1048909116 8:139117378-139117400 CTGTGTGAATCAAACTCTGGAGG + Intergenic
1049365493 8:142234923-142234945 CTGGGGCACTCACACACTGGTGG - Intronic
1051870283 9:21728948-21728970 CTGTGGCAGTCTCACCGTGGGGG + Intergenic
1051901880 9:22052012-22052034 CTGTGGTCCTCACATCATGGTGG + Intergenic
1052740210 9:32385059-32385081 GTGCGGGCCTCACACCCTCGGGG - Intronic
1055082288 9:72279269-72279291 CTGTGTCCCTCACACCCTGGTGG + Intergenic
1056793517 9:89640923-89640945 CTTTGGAACTCACTTCCTGGGGG - Intergenic
1057230718 9:93319817-93319839 CTGTGGGACTCAGCGCATGGTGG + Intronic
1059050207 9:110916547-110916569 CTTTGTGACTCAGACCCAGGTGG + Intronic
1059329578 9:113526385-113526407 CTCTGGGGCTCATAGCCTGGTGG + Intronic
1060964503 9:127705218-127705240 CTGTGAGACACAAACCCTGCAGG - Intronic
1061906406 9:133701597-133701619 CTGTGGGACTCTGGCCCTCGAGG - Intronic
1062151797 9:135023245-135023267 CTGTGAGACACACACCATGCTGG - Intergenic
1062267339 9:135693230-135693252 CTGTGGGACCTGCTCCCTGGAGG - Intergenic
1062287371 9:135779124-135779146 CTGTGGGACTCTCAGGGTGGAGG - Intronic
1062349370 9:136131589-136131611 CTGTGGGACTCCCACCTAGAGGG - Intergenic
1186169992 X:6866821-6866843 CTATGGGACTCACATTATGGTGG + Intergenic
1188032110 X:25275645-25275667 CAGTGGGACTCACACCTGGGTGG + Intergenic
1190157323 X:48004529-48004551 ATGTGGGACACACACACCGGGGG + Intronic
1190173093 X:48127414-48127436 ATGTGGGACACACACACCGGGGG + Intergenic
1192331789 X:70181497-70181519 CTGTGGGCATCACGCCCTGTTGG - Intronic
1194755792 X:97737707-97737729 CTTTGGGCCTTACAACCTGGGGG + Intergenic
1196613254 X:117737849-117737871 TCGTGGGCCTCACATCCTGGAGG - Intergenic
1198425773 X:136518716-136518738 CTCTAGGACTCACATCTTGGAGG - Intergenic
1201560338 Y:15309624-15309646 CAGTGGGACTCACATTATGGTGG + Intergenic