ID: 992857679

View in Genome Browser
Species Human (GRCh38)
Location 5:80879730-80879752
Sequence GTTTCTAAGCTGAAGGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992857679_992857683 10 Left 992857679 5:80879730-80879752 CCAAACTCCTTCAGCTTAGAAAC No data
Right 992857683 5:80879763-80879785 GATGTTTCTTTTCATAATGAAGG No data
992857679_992857685 26 Left 992857679 5:80879730-80879752 CCAAACTCCTTCAGCTTAGAAAC No data
Right 992857685 5:80879779-80879801 ATGAAGGCACCATTTCACTAGGG No data
992857679_992857684 25 Left 992857679 5:80879730-80879752 CCAAACTCCTTCAGCTTAGAAAC No data
Right 992857684 5:80879778-80879800 AATGAAGGCACCATTTCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992857679 Original CRISPR GTTTCTAAGCTGAAGGAGTT TGG (reversed) Intergenic
No off target data available for this crispr