ID: 992860174

View in Genome Browser
Species Human (GRCh38)
Location 5:80901342-80901364
Sequence CATTTCCCATTTATGACGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992860168_992860174 25 Left 992860168 5:80901294-80901316 CCATGACCAATCAGAGGCTGAAG No data
Right 992860174 5:80901342-80901364 CATTTCCCATTTATGACGTATGG No data
992860167_992860174 26 Left 992860167 5:80901293-80901315 CCCATGACCAATCAGAGGCTGAA No data
Right 992860174 5:80901342-80901364 CATTTCCCATTTATGACGTATGG No data
992860173_992860174 -9 Left 992860173 5:80901328-80901350 CCTGTGATCAAAGGCATTTCCCA No data
Right 992860174 5:80901342-80901364 CATTTCCCATTTATGACGTATGG No data
992860172_992860174 -4 Left 992860172 5:80901323-80901345 CCTGTCCTGTGATCAAAGGCATT No data
Right 992860174 5:80901342-80901364 CATTTCCCATTTATGACGTATGG No data
992860170_992860174 19 Left 992860170 5:80901300-80901322 CCAATCAGAGGCTGAAGTGGAAG No data
Right 992860174 5:80901342-80901364 CATTTCCCATTTATGACGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992860174 Original CRISPR CATTTCCCATTTATGACGTA TGG Intergenic
No off target data available for this crispr