ID: 992861222

View in Genome Browser
Species Human (GRCh38)
Location 5:80912463-80912485
Sequence AGCTGACAGTACTGGAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992861219_992861222 22 Left 992861219 5:80912418-80912440 CCATGAGATACATCTGCACACTT No data
Right 992861222 5:80912463-80912485 AGCTGACAGTACTGGAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992861222 Original CRISPR AGCTGACAGTACTGGAGTCC TGG Intergenic
No off target data available for this crispr